| CB47 |
C. elegans |
unc-11(e47) I. Show Description
|
|
| CB4711 |
C. elegans |
mab-5(e1239) egl-5(n945) III. Show Description
n945: HSN-. Egl. Coiler.
|
|
| CB4760 |
C. elegans |
fem-1(e2044) mor-2(e1125) unc-24(e158) fem-3(q20) / unc-5(e53) dpy-20(e1282) IV Show Description
Wild-type hermaphrodites segregating wild-type hermaphrodites, Unc-24 females, Unc Dpy hermaphrodites. Maintain by picking wild-type hermaphrodites. Deletion allele of fem-1, with unusual maternal effect. Reference: Spence AM, et al. Cell. 1990 Mar 23;60(6):981-90. Johnson CL & Spence AM.. Science. 2011 Sep 2;333(6047):1311-4.
|
|
| CB4857 |
C. elegans |
C. elegans wild isolate. Show Description
Isolated from decaying mushroom during rain in Claremont, CA in November 1972. Wild type. Low copy Tc1, pattern II. Reference WBG 10(2) 140-141 and 11(5) 60. Caenorhabditis elegans wild isolate. CB subclone of Cl2a (Tc1 pattern II). To obtain ECA249, a sequenced isolate of this wild strain, or other whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).
|
|
| CB5311 |
C. elegans |
egl-26(e1952e2650) II; him-8(e1489) IV. Show Description
Partial intragenic revertant. Weak Egl phenotype, less severe than egl-26(e1952). Reference: Hodgkin (1986) PMID: 3770465.
|
|
| CB5337 |
C. elegans |
sma-8(e2656) V. Show Description
Small, blunt rounded nose; heterozygous e2656/+ are animals similar, XO males can mate. Molecularly and phenotypically different from sma-8(e2111).
|
|
| CB5611 |
C. elegans |
bus-3(e2696) I. Show Description
Resistant to infection by Microbacterium nematophilum (no tail swelling).
|
|
| CB611 |
C. elegans |
unc-23(e611) V. Show Description
Head abnormal. Variable expression. M-MATING+++ 10-30%WT.
|
|
| CB6246 |
C. elegans |
sqt-3(e2911) V. Show Description
Slightly dumpy. Variable cold-sensitive lethal (poor viability at 15C). Unusual missense allele (D297G) of sqt-3, suppresses dpy-31 lethality. Reference: Novelli et al. (2006) PMID: 16452136.
|
|
| CB6667 |
C. elegans |
bus-12(e2977) IV. Show Description
Bus: resistant to M. nematophilum, Leucobacter Verde2; hypersensitive to Leucobacter Verde1. Strong nonsense mutation of bus-12 (Gln123Amber); reference null allele. Reference: Gravato-Nobre et al. (2011) PMID: 20980242.
|
|
| CB6858 |
C. elegans |
srf-10(yj10) bus-12(e2997) IV. Show Description
Viable, surface abnormal, Bus (resistant to infection by M. nematophilum), resistant to Leucobacter Verde2, hypersensitive to Leucobacter Verde1. Reference: Gravato-Nobre et al. (2011) PMID: 20980242.
|
|
| CB791 |
C. elegans |
unc-5(e791) IV. Show Description
Superficially wild-type. References: Rosu S, et al. Science. 2011 Dec 2;334(6060):1286-9. doi: 10.1126/science.1212424. PMID: 22144627. Toraason E, et al. Curr Biol. 2021 Apr 12;31(7):1508-1514.e5. doi: 10.1016/j.cub.2021.03.008. Epub 2021 Mar 18. PMID: 33740427. Toraason E, et al. Elife. 2024 Aug 8;13:e80687. doi: 10.7554/eLife.80687. PMID: 39115289.
|
|
| CER348 |
C. elegans |
trxr-1(cer35[Sec666C]) IV. Show Description
Missense mutation selenocysteine to cysteine. Resistant to cisplatin exposure. Primers to genotype this missense mutation and other silent mutations: [Common Fw: GGCTTCCACATTCTCACTCC] [RV wildtype: CTTAACCTCAGCAACCAGAA] [RV Sec to Cys: CTTAACCGCAACATCCGCTG] Reference: García-Rodríguez FJ, et al. Dis Model Mech. 2018 Jun 21;11(6).
|
|
| CER374 |
C. elegans |
trxr-1(cer55[Sec666X]) IV. Show Description
Missense mutation engineered by CRISPR removes a selenocysteine to place a stop codon. Resistance to cisplatin exposure. Primers to genotype the cer55 and other silent mutations: [Common Fw: #1224 GGCTTCCACATTCTCACTCC] [RV wildtype: #1414 cTTAACCTCAGCAACCAGAA] [RV Sec to STOP: #1421 CTTAACCTTAACATCCGCTG] Reference: García-Rodríguez FJ, et al. Dis Model Mech. 2018 Jun 21;11(6).
|
|
| CF1514 |
C. elegans |
daf-16(mu86) I; daf-2(e1370) III; muEx211. Show Description
muEx211[pNL213(ges-1p::GFP::daf-16) + rol-6(su1006)]. Grows at 15C (probably also at 20C). Pick Rollers to maintain.
|
|
| CF1660 |
C. elegans |
daf-16(mu86) I; daf-2(e1370) III; muIs84; muEx211. Show Description
muIs84 [(pAD76) sod-3p::GFP + rol-6(su1006)]. muEx211 [ges-1p::daf-16::GFP + rol-6(su1006)]. Pick Rollers to maintain. Partial rescue of lifespan phenotype. Some animals show variable daf-16 expression in the intestine. Grows okay at 15C. [NOTE: muEx211 is quite unstable. Be sure to pick Rollers to avoid losing the array.]
|
|
| CF2005 |
C. elegans |
daf-16(mu86) I; daf-2(e1370) III; muIs120. Show Description
muIs120 [ges-1p::GFP::daf-16 + rol-6(su1006)]. Maintain at 15-20C. Rollers. Long-lived. Gamma irradiation-induced integration of muEx211. Rescues daf-16a1/c in the intestine (described in Libina et al, 2003). Reference: Zhang P, et al. Cell Metab, 2013. 17(1): p. 85-100.
|
|
| CF2037 |
C. elegans |
muEx311. Show Description
muEx311 [pep-2p::RFP(NLS) + rol-6(su1006)]. Pick Rollers to maintain. pep-2 is an other name for pept-1. Reference: Zhang P, et al. Cell Metab. 2013 Jan 8;17(1):85-100.
|
|
| CF2248 |
C. elegans |
daf-16(mu86) I; glp-1(e2141) III; daf-12(rh61rh411) X; muEx158. Show Description
muEx158 [daf-16AM::GFP + sur-5p::GFP]. Pick GFP+ worms to maintain. Sterile at 25C; grow at 20C or less.
|
|
| CF2278 |
C. elegans |
daf-16(mu86) I; glp-1(e2141) III; daf-12(rh61rh411) X; muEx248. Show Description
muEx248 [daf-16p::GFP::DAF-16 cDNA + odr-1p::RFP]. Sterile at 25C; grow at 20C or less. Pick RFP+/GFP+ animals to maintain.
|
|
| CF311 |
C. elegans |
mab-5(e1239) egl-5(n945) III; him-5(e1490) V. Show Description
|
|
| CF4586 |
C. elegans |
muIs252 II; unc-119(ed3) III; vha-13(mu493[wrmScarlet11::vha-13]) V. Show Description
muIs252 [eft-3p::wrmScarlet1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. Homozygous viable. Endogenously-tagged wrmScarlet11::vha-13 generated via CRISPR/Cas9 insertion into parental strain CF4582. Reference: Goudeau J, et al. Genetics. 2021 Apr 15;217(4):iyab014. doi: 10.1093/genetics/iyab014. PMID: 33693628
|
|
| CF4592 |
C. elegans |
muIs253 II; unc-119(ed3) III; his-3(mu496[his-3::sfGFP11]) V. Show Description
muIs253 [eft-3p::sfGFP1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. Somatic expression of sfGFP1-10 (under the control of the eft-3 promoter and the unc-54 3'UTR). GFP11 tag inserted into endogenous his-3 locus via CRISPR/Cas9 insertion into parental strain CF4587. Reference: Goudeau J, et al. Genetics. 2021 Apr 15;217(4):iyab014. doi: 10.1093/genetics/iyab014. PMID: 33693628
|
|
| CF4594 |
C. elegans |
muIs252 II; unc-119(ed3) III; his-3(mu497[his-3::wrmScarlet11]) V. Show Description
muIs252 [eft-3p::wrmScarlet1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. Homozygous viable. Endogenously-tagged his-3::wrmScarlet11 generated via CRISPR/Cas9 insertion into parental strain CF4582. Reference: Goudeau J, et al. Genetics. 2021 Apr 15;217(4):iyab014. doi: 10.1093/genetics/iyab014. PMID: 33693628
|
|
| CF4601 |
C. elegans |
muIs252 II; unc-119(ed3) III; fib-1(mu498[wrmScarlet11::fib-1]) V. Show Description
muIs252 [eft-3p::wrmScarlet1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. Homozygous viable. Endogenously-tagged wrmScarlet11::linker::fib-1 generated via CRISPR/Cas9 insertion into parental strain CF4582. Reference: Goudeau J, et al. Genetics. 2021 Apr 15;217(4):iyab014. doi: 10.1093/genetics/iyab014. PMID: 33693628
|
|
| CF4608 |
C. elegans |
muIs252 II; unc-119(ed3) III; his-3(mu500[his-3::wrmScarlet11(x3)]) V. Show Description
muIs252 [eft-3p::wrmScarlet1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. Homozygous viable. Endogenously-tagged his-3::wrmScarlet11(x3) generated via CRISPR/Cas9 insertion of three wrmScarlet11 tags into the endogenous his-3 locus in parental strain CF4582. Reference: Goudeau J, et al. Genetics. 2021 Apr 15;217(4):iyab014. doi: 10.1093/genetics/iyab014. PMID: 33693628
|
|
| CF4611 |
C. elegans |
muIs257 I; fib-1(mu498[wrmScarlet11::fib-1]) V. Show Description
muIs257 [myo-3p::wrmScarlet1-10::unc-54 3'UTR] I. Homozygous viable. Endogenously-tagged wrmScarlet11::linker::fib-1 generated via CRISPR/Cas9 insertion into parental strain CF4610. Reference: Goudeau J, et al. Genetics. 2021 Apr 15;217(4):iyab014. doi: 10.1093/genetics/iyab014. PMID: 33693628
|
|
| CF4614 |
C. elegans |
muIs252 II; tbb-2(muIs260[wrmScarlet11::tbb-2]) unc-119(ed3) III. Show Description
muIs252 [eft-3p::wrmScarlet1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. split-wrmScarlet11 inserted at the N-terminus of the endogenous tbb-2 locus; detectable in all somatic tissues where wrmScarlet1-10 is present. Figure 3B from Goudeau et al., Genetics 2021. Reference: Goudeau J, et al. Genetics. 2021 Apr; 217(4): iyab014. PMID: 33693628.
|
|
| CF4616 |
C. elegans |
muIs252 II; unc-119(ed3) III; vha-13(muIs264[wrmScarlet11(x2)::vha-13]) V. Show Description
muIs252 [eft-3p::wrmScarlet1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. Two tandem repeats of split-wrmScarlet11 inserted at the N-terminus of the endogenous VHA-13 locus; detectable in somatic tissues where wrmScarlet1-10 is present. Figure 4A from Goudeau et al., Genetics 2021. Reference: Goudeau J, et al. Genetics. 2021 Apr; 217(4): iyab014. PMID: 33693628.
|
|
| CF4625 |
C. elegans |
muIs252 II; unc-119(ed3) III; tomm-20(muIs276[tomm-20::wrmScarlet11(MDELYK)]) V. Show Description
muIs252 [eft-3p::wrmScarlet1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. split-wrmScarlet11(MDELYK) inserted at the C-terminus of the endogenous TOMM-20 locus; detectable in somatic tissues where wrmScarlet1-10 is present. Figure S6B from Goudeau et al., Genetics 2021. Reference: Goudeau J, et al. Genetics. 2021 Apr; 217(4): iyab014. PMID: 33693628.
|
|
| CF4639 |
C. elegans |
glh-1(sam140[glh-1::T2A::wrmScarlet(1-10)]) I; fib-1(mu498[wrmScarlet11::fib-1]) V. Show Description
fib-1(mu498[wrmScarlet11::fib-1]) generated via CRISPR/Cas9 insertion into parental strain DUP237; transgene contains a linker between wrmScarlet11 and fib-1. Endogenous fib-1 detectable in the germline. T2A::wrmScarlet(1-10) fused to the C-terminus of endogenous GLH-1. The T2A self-cleaving peptide separates wrmScarlet(1-10) from GLH-1 post-translationally so that wrmScarlet(1-10) disperses throughout germ cell nuclei and cytoplasm. wrmScarlet(1-10) is also maternally loaded into embryos, where it persists through early and mid-embryonic development. Reference: Goudeau J, et al. bioRxiv 2020.07.02.185249; doi: https://doi.org/10.1101/2020.07.02.185249. Goudeau J, et al. Genetics. 2021 Apr; 217(4): iyab014. PMID: 33693628.
|
|
| CFJ111 |
C. elegans |
kstSi61 II; unc-119(ed3) III. Show Description
kstSi61 [LoxP + Cbr-unc-119(+) + LoxP + hygroR(kst31)] II. N2-like, no hygromycin resistance (HygroR). hygroR(kst31) is a partial, non-functional hygromycin-resistance construct used for section in MosTI, an updated technique for targeted single-copy and extra-chromosomal array insertion. Cbr-unc-119(+) is flanked by LoxP sites, facilitating removal by recombination. Reference: El Mouridi S, et al. 2022.
|
|
| CG1 |
C. elegans |
lev-11(rg1) I; him-5(e1490) V. Show Description
Resistant to levamisole. Egl-d. Twitch at 25C. Long. Throws males.
|
|
| CGC11 |
C. elegans |
unc-5(e53)/nT1 [umnIs1] IV; dpy-11(e224)/nT1 V. Show Description
umnIs1 [eft-3p::GFP + HygroR, V:~2821000] V. umnIs1 GFP is expressed at low levels, and might be difficult to see in heterozygotes. Heterozygotes are WT and segregate WT, DpyUnc, Vul and dead eggs. Maintain by picking GFP+ WT. Derived by insertion of GFP transgene into parental strain MT1000 using MosSCI.
|
|
| CGC111 |
C. elegans |
mir-250(umn22[lox2272 myo-2p::wrmScarlet + lox511I + lox2272)] V. Show Description
Derived by CRE-meditated excision of SEC in parental strain CGC110, leaving myo-2p::wrmScarlet.
|
|
| CGC13 |
C. elegans |
unc-5(e53)/nT1 [umnIs3] IV; dpy-11(e224)/nT1 V. Show Description
umnIs3 [eft-3p::NLS::tdTomato + HygroR, V:~2821000] IV. tdTomato is expressed at low levels, and might be difficult to see in heterozygotes. Heterozygotes are WT and segregate WT, DpyUnc, Vul and dead eggs. Maintain by picking WT with tdTomato expression. Derived by insertion of tdTomato transgene into parental strain MT1000 using CRISPR/Cas9.
|
|
| CGC138 |
C. elegans |
unc-13(e51)/hT1 I; dpy-11(e224)/hT1 [unc-42(e270) umnIs79] V. Show Description
umnIs79 [myo-2p::GFP + NeoR, I: 6284001] I. Pick wild-type GFP+ to maintain. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+, DpyUnc, arrested hT1 homozygotes (GFP+), and dead eggs. Maintain by picking wild-type GFP+. Derived by insertion of myo-2p::GFP transgene into hT1 balancer in parental strain KR1037 using CRISPR/Cas9.
|
|
| CGC139 |
C. elegans |
unc-13(e51)/hT1 I; dpy-11(e224)/hT1 [unc-42(e270) umnIs80] V. Show Description
umnIs80 [myo-2p::mKate2 + NeoR, I: 6284001] I. Pick wild-type mKate2+ to maintain. Heterozygotes are wild-type mKate2+, and segregate wild-type mKate2+, DpyUnc, arrested hT1 homozygotes (mKate2+), and dead eggs. Maintain by picking wild-type mKate2+. Derived by insertion of myo-2p::mKate transgene into hT1 balancer in parental strain KR1037 using CRISPR/Cas9.
|
|
| CGC22 |
C. elegans |
umnIs11 V. Show Description
umnIs11 [myo-2p::GFP + NeoR, V:1005689 (intergenic)] V. Derived by insertion of myo-2p::GFP transgene into parental strain N2 using CRISPR/Cas9.
|
|
| CGC29 |
C. elegans |
unc-13(e51)/hT1 [umnIs18] I; dpy-11(e224)/hT1 [unc-42(e270)] V. Show Description
umnIs18 [myo-2p::GFP + NeoR, V: 1005689 (intergenic)] I. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+, Dpy Unc, arrested hT1 homozygotes(GFP+), and dead eggs. Maintain by picking wild-type GFP+. Derived by insertion of myo-2p::GFP transgene into hT1 balancer in parental strain KR1037 using CRISPR/Cas9.
|
|
| CGC33 |
C. elegans |
unc-5(e53)/nT1 [umnIs22] IV; dpy-11(e224)/nT1 V. Show Description
umnIs22 [myo-2p::GFP + NeoR, V: 1005689 (intergenic)] IV. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+, DpyUnc, Vul GFP+ (nT1) and dead eggs. Maintain by picking wild-type GFP+. Derived by insertion of myo-2p::GFP transgene into nT1 balancer in parental strain MT1000 using CRISPR/Cas9.
|
|
| CGC39 |
C. elegans |
unc-5(e53)/nT1 IV; dpy-11(e224)/nT1 [umnIs28] V. Show Description
umnIs28 [myo-2p::GFP + NeoR, IV: 12457861 (intergenic)] V. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+, DpyUnc, Vul GFP+ (nT1) and dead eggs. Maintain by picking wild-type GFP+. Derived by insertion of myo-2p::GFP transgene into nT1 balancer in parental strain MT1000 using CRISPR/Cas9.
|
|
| CGC5 |
C. elegans |
umnTi2 III. Show Description
umnTi2 [eft-3p::GFP + unc-119(+)]. Integration site: (III:+13.25 cM/nt 11,816,400). Might still contain unc-119(ed3) in background.
|
|
| CGC63 |
C. elegans |
unc-5(e53)/nT1 [umnIs49] IV; dpy-11(e224)/nT1 V. Show Description
umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Heterozygotes are wild-type mKate2+, and segregate wild-type mKate2+, DpyUnc, Vul mKate2+ (nT1) and dead eggs. Maintain by picking wild-type mKate2+. Derived by insertion of myo-2p::mKate2 transgene into nT1 balancer in parental strain MT1000 using CRISPR/Cas9.
|
|
| CGC71 |
C. elegans |
unc-5(e53)/nT1 IV; dpy-11(e224)/nT1 [umnIs57] V. Show Description
umnIs57 [myo-2p::mKate2 + NeoR, IV: 12457861 (intergenic)] V. Heterozygotes are wild-type mKate2+, and segregate wild-type mKate2+, DpyUnc, Vul mKate2+ (nT1) and dead eggs. Maintain by picking wild-type mKate2+. Derived by insertion of myo-2p::mKate2 transgene into nT1 balancer in parental strain MT1000 using CRISPR/Cas9.
|
|
| CGC75 |
C. elegans |
unc-13(e51)/hT1 [umnIs58] I; dpy-11(e224)/hT1 [unc-42(e270)] V. Show Description
umnIs58 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] V. Pick wild-type mKate2+ to maintain. Heterozygotes are wild-type mKate2+, and segregate wild-type mKate2+, DpyUnc, arrested hT1 homozygotes (mKate2+), and dead eggs. Maintain by picking wild-type mKate2+. Derived by insertion of myo-2p::mKate2 transgene into hT1 balancer in parental strain KR1037 using CRISPR/Cas9.
|
|
| CGC83 |
C. elegans |
tmIn8 [umnIs64] II. Show Description
umnIs64 [myo-2p::GFP + NeoR, II:12833878 (intergenic)] II. tmIn8 is a CRISPR/Cas9-induced inversion between F13D12.6 and cup-14 in LG II covering region (Mb) 2.1 (11.7..13.9). Derived by insertion of myo-2p::GFP transgene into parental strain FX19134 using CRISPR/Cas9.
|
|
| CH120 |
C. elegans |
cle-1(cg120) I. Show Description
Homozygous viable and fertile. Partially penetrant Egl and cell/axon guidance defects. Deletion of nucleotides 22756-24758 based on cosmid F39H11 sequence (Genbank AF164959). Results in loss of carboxyl NC1 domain from CLE-1.
|
|
| CHS1002 |
C. elegans |
srh-105(yum1122) II; srh-109(yum1123) srh-111(yum1124) V. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
|
|
| CHS1003 |
C. elegans |
srh-105(yum1122) II; srh-104(yum1126) srh-102(yum1125) srh-109(yum1123) srh-111(yum1124) V. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
|
|