Heterozygotes are WT and segregate WT, Dpy and lethals which die in larval development. See also WBPaper00001202.

Heterozygotes are slow moving. Segregates paralysed small. eDf1 eDp21 homozygotes die in larval development.

Movement slow. Suppressed Unc. Revertant. Heterozygotes move slowly and segregate larval lethals (eDf1 eDp21 homozygotes), and paralyzed Uncs.

Heterozygotes are slow moving. Hets segregate DpyUncs. Hets segregate larval lethals (eDf1 eDp21 homozygotes).

Heterozygotes are WT and segregate WT, Sma and lethals which die in larval development.

Homozygous viable. Deficiency of 4040 bp, removes his-55, his-56, his-58 and his-57, with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: aaacgtggtactgtaatcgttgcgagacct ; Right flanking sequence: actgtttaattttaaaagcgtctataacgt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

maIs103[rnr::GFP unc-36(+)]. Heterozygotes produce 1/4 thin, sterile, uncoordinated animals that fail to undergo postembryonic somatic cell divisions. rnr::GFP is expressed during S-phase in heterozygous animals. rnr::GFP expression is not detected in heDf1 animals. Although the map position of maIs103 has not been determined conclusively, maIs103 genetically behaves linked to cdk-4. Maintain by picking several single animals and scoring for 1/4 mutant progeny.

maIs103[rnr::GFP unc-36(+)] X. Heterozygotes produce 1/4 thin, sterile, uncoordinated animals that fail to undergo postembryonic somatic cell divisions. rnr::GFP is expressed during S-phase in heterozygous animals. rnr::GFP expression is not detected in heDf1 animals. Although the map position of maIs103 has not been determined conclusively, maIs103 genetically behaves linked to cdk-4. Maintain by picking several single animals and scoring for 1/4 mutant progeny.

maIs103[rnr::GFP unc-36(+)] X. The heDf1 deletion includes cdk-4. Heterozygotes produce 1/4 thin, sterile, uncoordinated animals that fail to undergo postembryonic somatic cell divisions. heDf1 mutants are of L1 size, smaller than cdk-4 mutants. lon-2 and unc-9 do not exactly balance heDf1, but unc-9 is pretty close. It should also be possible to follow the heterozygotes by looking at the GFP. Despite trying, unable to separate the maIs integration from heDf1 or the other cdk-4 alleles. By maintaining animals with GFP (visible especially in early animals and in eggs) you should be able to maintain heDf1. rnr::GFP is expressed during S-phase in heterozygous animals. rnr::GFP expression is not detected in heDf1 animals. maIs103 is tightly linked to heDf1. Maintain by picking several single animals and scoring for 1/4 mutant progeny.

No obvious altered phenotype. Deletion removes 1.9 kb from within pes-1, including more than half of the forkhead domain encoding region.

Hets are WT and segregate WT, dead eggs, and larval lethals (eDf24 homozygotes). eDf24 = let(e2000).

Hets are WT and segregate WT, dead eggs, and larval lethals (eDf24 homozygotes). eDf24 = let(e2000).

Hets are WT and segregate WT, dead eggs, and larval lethals (eDf24 homozygotes). eDf24 = let(e2000).

Heterozygotes are WT. eDf24 homozygotes arrest as early larvae. eDf24 = let(e2000).

Heterozygotes are WT. eDf24 homozygotes arrest as early larvae. eDf24 = let(e2000).

Heterozygotes are WT. eDf24 homozygotes arrest as early larvae. eDf24 = let(e2000).

Heterozygotes are WT. eDf24 homozygotes arrest as early larvae. eDf24 = let(e2000).

Heterozygotes are WT and segregate WT, DpyUnc and dead eggs. Maintain by picking WT.

Heterozygotes are WT (somewhat Unc and Egl) and segregate WT, DpyUnc and dead eggs. Maintain by picking WT.

Heterozygotes mostly fertile at or below 20C; all sterile at 25C. Progeny are fertile heterozygotes with variable Gon abnormality, e1254 homozygotes (strong Gon, "white patch" phenotype) and eDf18 homozygotes (embryonic lethal). See also WBPaper00003841.

Wild-type segregating wild-type, Unc-101 (hIn1[unc-101] homozygotes) and arrested crescent-shaped larvae (eDf13 homozygotes, probably L1). Pick WT and check for correct segregation of progeny to maintain. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to Ann Rose.

Wild-type segregating wild-type, Unc-101 (hIn1[unc-101] homozygotes) and arrested crescent-shaped larvae (eDf14 homozygotes, probably L1). Pick WT and check for correct segregation of progeny to maintain. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to Ann Rose.