AE501 |
C. elegans |
nhr-8(ok186) IV. Show Description
Approx. 1.3 kb deletion - does not remove entire coding region, might not be null allele. No overt morphological or behavioral abnormalities. Homozygotes are 2-3X more sensitive to colchicine and chloroquine than are N2 animals.
|
|
BC313 |
C. elegans |
rec-1(s180) I. Show Description
Increased recombination (3X - 4X over WT) for linkage groups I, IV and V. Recessive. Dominant with s155.
|
|
CB3911 |
C. elegans |
dpy-27(rh18) III; 4A;3X. Show Description
Non-Dpy 4A;3X hermaphrodites segregating 4A;3X hermaphrodites, 4A;2X males and dead or very dumpy 4A;4X hermaphrodites. Reference: Strain 19 in Hodgkin (2002) PMID: 12399387
|
|
CB6129 |
C. elegans |
dpy-27(rh18) III; fem-1(hc17) IV. [4A;3X] Show Description
Temperature-sensitive: Maintain at 15C. Stable, temperature-sensitive tetraploid strain: fertile 4A;3X hermaphrodites and 4A;2X males at 15C; fertile 4A;3X females and feminized sterile 4A;2X males at 25C. Reference: Hodgkin (2002) PMID: 12399387.
|
|
CU7905 |
C. elegans |
smIs350 IV; unc-76(e911) V. Show Description
smIs350 [hsp-16::mCherry-NLS + tra-2::FLAG(3x) + unc-76(+)] IV. Some sterility. Maintain under normal conditions. Reference: Mapes J, et al. (2010) PNAS In press.
|
|
EG5003 |
C. elegans |
unc-119(ed3) III; cxTi10882 IV. Show Description
Unc. Not caused by cxTi10882. EG5003 contains background mutations (partial deletion of pgp-6 and pgp-7 and a deletion close to cTel3x.1). EG6250 is an outcrossed version of this strain. Mos1 allele generated by NemaGENETAG consortium (Laurent Segalat).
|
|
JK5500 |
C. elegans |
sygl-1(q828) I; qSi150 II. Show Description
qSi150 [sygl-1p::3X flag::sygl-1::tbb-2 3' UTR + Cbr-unc-119(+)] II. Phenotypically gravid, grows as a homozygote. Increased SYGL-1 protein expression, expanded progenitor zone, expanded GSC pool. Reference: Shin H. et al. PLoS Genet. 2017 Dec 12;13(12):e1007121.
|
|
JK6080 |
C. elegans |
puf-3(q1058[3xV5::puf-3]) IV. Show Description
3x V5 epitope tags inserted into endogenous puf-3 locus. Expresses functional 3x V5-tagged PUF-3. Reference: Haupt KA, Genetics. 2020 Jan;214(1):147-161. PMID: 31740451
|
|
JK6280 |
C. elegans |
puf-11(q1128[3xV5::puf-11]) IV. Show Description
3x V5 epitope tags inserted into endogenous puf-11 locus. Expresses functional 3x V5-tagged PUF-11. Reference: Haupt KA, Genetics. 2020 Jan;214(1):147-161. PMID: 31740451
|
|
LP858 |
C. elegans |
lea-1(cp431[mNG::3x FLAG::AID::lea-1]) V. Show Description
Endogenous LEA-1 tagged at the C-terminus with mNG and AID* sequence for auxin-induced degradation. Reference: Hibshman JD & Goldstein B. BMC Biol. 2021 Dec 14;19(1):263. doi: 10.1186/s12915-021-01176-0. PMID: 34903234
|
|
LP859 |
C. elegans |
lea-1(cp430[lea-1::mYPet::3x FLAG]) V. Show Description
Endogenous LEA-1 tagged at the C-terminus with mYPet. Reference: Hibshman JD & Goldstein B. BMC Biol. 2021 Dec 14;19(1):263. doi: 10.1186/s12915-021-01176-0. PMID: 34903234
|
|
LP860 |
C. elegans |
daf-2(e1370) III; lea-1(cp431[mNG::3x FLAG::AID::lea-1]) V. Show Description
Endogenous LEA-1 tagged at the C-terminus with mNG and AID* sequence for auxin-induced degradation. Maintain at 15C. Reference: Hibshman JD & Goldstein B. BMC Biol. 2021 Dec 14;19(1):263. doi: 10.1186/s12915-021-01176-0. PMID: 34903234
|
|
LP861 |
C. elegans |
daf-2(e1370) III; lea-1(cp430[lea-1::mYPET::3x FLAG]) V. Show Description
Endogenous LEA-1 tagged at the C-terminus with mYPET. Maintain at 15C. Reference: Hibshman JD & Goldstein B. BMC Biol. 2021 Dec 14;19(1):263. doi: 10.1186/s12915-021-01176-0. PMID: 34903234
|
|
NLS1 |
C. elegans |
cdc-7(knu709) I. Show Description
CRISPR-engineered deletion removing entire cdc-7 gene. Out-crossed 3x to N2. Reference: Currey HN & Liachko NF. 2019. A CRISPR/Cas9-generated cdc-7 loss of function mutation does not cause temperature-dependent fertility defects. microPublication Biology. Jan 3;2019:10.17912.
|
|
OH15500 |
C. elegans |
otIs669 V; otIs672. Show Description
otIs672 [rab-3::NLS::GCaMP6s + arrd-4:NLS:::GCaMP6s]. otIs669 [UPN::NLS::TagRFP-T + acr-5::NLS::mTagBFP2::H2B + flp-1::NLS::mTagBFP2::H2B + flp-6::NLS::mTagBFP2::H2B + flp-18::NLS::mTagBFP2::H2B + flp-19::NLS::mTagBFP2::H2B + flp-26::NLS::mTagBFP2::H2B + gcy-18::NLS::mTagBFP2::H2B + ggr-3::NLS::mTagBFP2::H2B + lim-4::NLS::mTagBFP2::H2B + pdfr-1::NLS::mTagBFP2::H2B + srab-20::NLS::mTagBFP2::H2B + unc-25::NLS::mTagBFP2::H2B + cho-1::NLS::CyOFP1::H2B + flp-13::NLS::CyOFP1::H2B + flp-20::NLS::CyOFP1::H2B + gcy-36::NLS::CyOFP1::H2B + gpa-1::NLS::CyOFP1::H2B + nlp-12::NLS::CyOFP1::H2B + nmr-1::NLS::CyOFP1::H2B + ocr-1::NLS::CyOFP1::H2B + osm-9::NLS::CyOFP1::H2B + srh-79::NLS::CyOFP1::H2B + sri-1::NLS::CyOFP1::H2B + srsx-3::NLS::CyOFP1::H2B + unc-8::NLS::CyOFP1::H2B + acr-2::NLS::mNeptune2.5 + ceh-2::NLS::mNeptune2.5 + dat-1::NLS::mNeptune2.5 + dhc-3::NLS::mNeptune2.5 + eat-4::NLS::mNeptune2.5 + flp-3::NLS::mNeptune2.5 + gcy-35::NLS::mNeptune2.5 + glr-1::NLS::mNeptune2.5 + gcy-21::NLS::CyOFP1::H2B::T2A::NLS::mTagBFP2::H2B + klp-6::NLS::mNeptune2.5::T2A::NLS::CyOFP1::H2B + lim-6::NLS::mNeptune2.5::T2A::NLS::CyOFP1::H2B + mbr-1::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B + mec-3::NLS::CyOFP1::H2B::T2A::NLS::mTagBFP2::H2B + odr-1::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B + srab-20::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B] V. UPN (Ultra Pan-Neuronal) promoter contains four short pan-neuronal promoters fused together (unc-11::rgef-1::ehs-1::ric-19). NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene used to resolve unique neural identities in whole-brain images. Bottlenecked 23x for isogenicity. Slow growing. Reference: Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642 Free pre-print available at https://www.biorxiv.org/content/10.1101/676312v2
|
|
UTR43 |
C. elegans |
par-4(nar12[par-4Ap::mNG + loxP sqt-1(gf) Hygromycin(+) loxP 3X FLAG]) V. Show Description
Homozygous viable, Rol. nar12 (non-excised strain) is null for par-4A & C, but not for par-4B, and is viable. Low rate of spontaneous excision even when maintained at 15C. Pick Rollers to maintain. Reference: Roy et al. microPublication Biology. https://www.micropublication.org/roy_2018_mngpar-4.html
|
|
UTR45 |
C. elegans |
par-4(nar13[mNG::3X FLAG::par-4a + loxP]) V. Show Description
Superficially wild-type. nar13 was derived by excision of UTR43(nar12) cassette by heat shock. Tagged endogenous PAR-4A & C: weak, ubiquitous fluorescence. Reference: Roy et al. microPublication Biology. https://www.micropublication.org/roy_2018_mngpar-4.html
|
|
AD294 |
C. elegans |
cylc-2(mon2[cylc-2::mNG::3xFLAG) I; him-5(e1490) V. Show Description
Endogenous cycl-2 locus tagged with mNeonGreen (mNG). Green fluorescence in sperm. Him. Reference: Krauchunas AR, et al. (2020). C. elegans CYLC-2 localizes to sperm. microPublication Biology. 10.17912/micropub.biology.000314.
|
|
ADS1002 |
C. elegans |
aeaIs10. Show Description
aeaIs10 [rgef-1p::GCaMP6s::3xNLS + lin-15(+)]. Worms express GCaMP6s in all neuronal nuclei. Pan-neuronal imaging strain; suitable for rapid whole-brain imaging due to brightness, good signal to noise ratio, and relative resistance to photo-bleaching. Reference: Susoy V, et al. Cell. 2021 Sep 30;184(20):5122-5137.e17. PMID: 34534446
|
|
BB259 |
C. elegans |
adr-1(uu49) I; adr-2(uu28) III; ggIs1 IV. Show Description
ggIs1 [nrde-3p::3xFlag::GFP::nrde-3 ORF + unc-119(+)] IV. Nuclear GFP::NRDE-3 signal. Lacks RNA editing. Reference: Reich DP, et al. Genes Dev. 2018 Feb 1;32(3-4):271-282.
|
|
BB278 |
C. elegans |
adr-1(uu49) I; rrf-3(uu56) II; adr-2(uu28) III; ggIs1 IV. Show Description
ggIs1 [nrde-3p::3xFlag::GFP::nrde-3 ORF + unc-119(+)] IV. Nuclear GFP::NRDE-3 signal. Enhanced RNAi. Lacks RNA editing. Vulval bursting. Low brood size. Triple mutants display bursting and low brood size phenotypes not observed in adr-1;adr-2 or rrf-3 parental strains. Reference: Reich DP, et al. Genes Dev. 2018 Feb 1;32(3-4):271-282.
|
|
BR7827 |
C.elegans |
endu-2(tm4977) X; byEx1551. Show Description
byEx1551 [vha-6p::endu-2::eGFP::3xFLAG + myo-2p::mCherry]. Pick mCherry+ animals to maintain array. Transgene provides intestinal rescue of endu-2(tm4977) that also rescues mortal germline (Mrt) phenotype. Reference: Qi W, et al. (2020) A secreted endoribonuclease ENDU-2 from the soma protects germline immortality in C. elegans. BioRxiv. doi: 10.1101/2020.12.04.408260. Accepted by Nature Communications.
|
|
BR8551 |
C.elegans |
endu-2(tm4977) X; byEx1795. Show Description
byEx1795 [unc-119p::endu-2::eGFP::3xFlag + rol-6(su1006)]. Pick Rollers to maintain. Transgene provides neuronal rescue of endu-2(tm4977) that also rescues mortal germline (Mrt) phenotype. Reference: Qi W, et al. (2020) A secreted endoribonuclease ENDU-2 from the soma protects germline immortality in C. elegans. BioRxiv. doi: 10.1101/2020.12.04.408260. Accepted by Nature Communications.
|
|
BS5633 |
C. elegans |
ieSi64 II; lag-1(oz536oz537[lag-1::degron::3xHA]) IV. Show Description
ieSi64 [gld-1p::TIR1::mRuby::gld-1 3'UTR + Cbr-unc-119(+)] II. Essentially wild-type when maintained on NGM plates. All germline stem cells enter into meiosis when treated with Auxin (1mM). References: Chen J, et al. PLoS Genet. 2020 Mar 20;16(3):e1008650. PMID: 32196486. Chen J, et al. 2020 MicroPublication (https://doi.org/10.17912/micropub.biology.000310) .
|
|
CA1369 |
C. elegans |
zhp-1(ie62[zhp-1::AID::3xFLAG]) I; meIs8 II; spo-11(ie59[spo-11::AID::3xFLAG]) ieSi38 IV. Show Description
meIs8 [pie-1p::GFP::cosa-1 + unc-119(+)] II. ieSi38 [sun-1p::TIR1::mRuby::sun-1 3'UTR + Cbr-unc-119(+)] IV. Single copy transgene inserted into chromosome IV (cxTi10882) expressing modified Arabidopsis thaliana TIR1 tagged with mRuby in germ line and early embryos. This strain can be used for auxin-inducible degradation (AID) in germ line and early embryos. References: Zhang L, et al. Development. 2015 Nov 9. pii: dev.129635. Zhang et al., Elife. 2018 Mar 9;7. pii: e30789.
|
|
CA1377 |
C. elegans |
zhp-2(ie67[zhp-2::AID::3xFLAG]) I; meIs8 II; spo-11(ie60[spo-11::AID::3xFLAG]) ieSi38 IV. Show Description
meIs8 [pie-1p::GFP::cosa-1 + unc-119(+)] II. ieSi38 [sun-1p::TIR1::mRuby::sun-1 3'UTR + Cbr-unc-119(+)] IV. Single copy transgene inserted into chromosome IV (cxTi10882) expressing modified Arabidopsis thaliana TIR1 tagged with mRuby in germ line and early embryos. This strain can be used for auxin-inducible degradation (AID) in germ line and early embryos. References: Zhang L, et al. Development. 2015 Nov 9. pii: dev.129635. Zhang et al., Elife. 2018 Mar 9;7. pii: e30789.
|
|
CA1421 |
C. elegans |
meIs8 dsb-2(ie58[dsb-2::AID::3xFLAG]) II; ieSi38 IV. Show Description
meIs8 [pie-1p::GFP::cosa-1 + unc-119(+)] II. ieSi38 [sun-1p::TIR1::mRuby::sun-1 3'UTR + Cbr-unc-119(+)] IV. Single copy transgene inserted into chromosome IV (cxTi10882) expressing modified Arabidopsis thaliana TIR1 tagged with mRuby in germ line and early embryos. This strain can be used for auxin-inducible degradation (AID) in germ line and early embryos. References: Zhang L, et al. Development. 2015 Nov 9. pii: dev.129635. Zhang et al., Elife. 2018 Mar 9;7. pii: e30789.
|
|
CA1423 |
C. elegans |
meIs8 II; spo-11(ie59[spo-11::AID::3xFLAG]) ieSi38 IV. Show Description
meIs8 [pie-1p::GFP::cosa-1 + unc-119(+)] II. ieSi38 [sun-1p::TIR1::mRuby::sun-1 3'UTR + Cbr-unc-119(+)] IV. Single copy transgene inserted into chromosome IV (cxTi10882) expressing modified Arabidopsis thaliana TIR1 tagged with mRuby in germ line and early embryos. This strain can be used for auxin-inducible degradation (AID) in germ line and early embryos. References: Zhang L, et al. Development. 2015 Nov 9. pii: dev.129635. Zhang et al., Elife. 2018 Mar 9;7. pii: e30789.
|
|
CZ25013 |
C. elegans |
unc-44(ju1413[unc-44::gfp::LoxP::3xflag]) IV. Show Description
unc-44(ju1413[unc-44::GFP::LoxP::3xflag]) IV. UNC-44C (short isoform of UNC-44) tagged with GFP. UNC-44C is strongly expressed in multiple tissues: nervous system (from 1.5-fold stage to adult), epidermis (from early embryo to adult), seam cells (from L1 to L4), vulva (from L3 to adult), and spermatheca/sheath cells (from L4 to adult). Reference: Chen F, Chisholm AD, Jin Y. Development. 2017 Feb 15;144(4):698-707.
|
|
CZ26494 |
C. elegans |
juSi364 IV; acr-2(n2420) X. Show Description
juSi364 [unc-17Bp::3xFLAG::eif-3.g::SL2::GFP] IV. GFP expression in cholinergic motor neurons. Convulsing worms. Strain is suitable for neuron-type eCLIP. Reference: Blazie S, et al. Elife. 2021 Jul 29;10:e68336. PMID: 34323215.
|
|
CZ27748 |
C. elegans |
vwa-8(ju1799[vwa-8::GFP::3xFLAG]) X. Show Description
Endogenous vwa-8 locus tagged with GFP and 3xFLAG. VWA-8::GFP is expressed in mitochondria of hypodermis, intestine, and muscle, but not detectable in neurons. Reference: Zhu, M, et al. A null mutation of C. elegans vwa-8. microPublication Biology. https://doi.org/10.17912/micropub.biology.000263.
|
|
DG4158 |
C. elegans |
spn-4(tn1699[spn-4::gfp::3xflag]) V. Show Description
Apparently wild type
|
|
DG4190 |
C. elegans |
cdc-25.3(tn1712[gfp::3xflag::cdc-25.3]) III. Show Description
Superficially wild type
|
|
DG4213 |
C. elegans |
meg-1(tn1724[gfp::3xflag::meg-1]) X. Show Description
Superficially wild type
|
|
DG4215 |
C. elegans |
puf-5(tn1726[gfp::3xflag::puf-5]) II. Show Description
Superficially wild type
|
|
DG4218 |
C. elegans |
cpg-1(tn1728[mng::3xflag::cpg-1]) III. Show Description
Superficially wild type
|
|
DG4222 |
C. elegans |
pos-1(tn1730[gfp::3xflag::pos-1]) V. Show Description
Superficially wild type
|
|
DG4228 |
C. elegans |
orc-1(tn1732[mNeonGreen::3xflag::orc-1]) III. Show Description
Superficially wild type
|
|
DG4230 |
C. elegans |
gla-3a(tn1734[gfp::3xflag::gla-3a]) I. Show Description
Superficially wild type
|
|
DG4233 |
C. elegans |
pqn-59(tn1737[gfp::3xflag::pqn-59]) I. Show Description
Superficially wild type
|
|
DG4269 |
C. elegans |
mex-3(tn1753[gfp::3xflag::mex-3]) I. Show Description
Superficially wild type
|
|
DG4392 |
C. elegans |
cyb-3(tn1755[gfp::3xflag::cyb-3]) V. Show Description
Although this strain is maintainable as a homozygote it produces many dead embryos (~80%) and has a low viable brood size (~24 ± 18). Thus, the GFP tag compromises CYB-3 function.
|
|
DG4569 |
C. elegans |
cyb-1(tn1806[cyb-1::gfp::tev::3xflag]) IV. Show Description
Viable and fertile, grows and moves well. No apparent abnormalities yet noted. Reference: Spike CA, et al. Genetics. 2022 May 5;221(1):iyac051.
doi: 10.1093/genetics/iyac051. PMID: 35377419
|
|
DQM455 |
C. elegans |
cki-1(bmd132[GFP::LoxP::cki-1::3xFLAG]) II. Show Description
CRISPR/Cas9 insertion of GFP into the N-terminus of cki-1; seems to cause cki-1 gain-of-function phenotype (early cell cycle exit for some post-embryonic blast cells). Reference: Adikes RC, et al. "Visualizing the metazoan proliferation-terminal differentiation decision in vivo." bioRxiv 2019.12.18.881888
|
|
DQM594 |
C. elegans |
bmdSi170 I. Show Description
bmdSi170 [loxN::eft-3p::his-58::GFP::3xHA] I. Superficially wild-type. bmdSi170 is a single-copy CRISPR/Cas9-engineered insertion of HIS-58 C-terminally tagged with non-codon-optimized GFP and driven by the ubiquitous eft-3 promoter. Reference: Azmi MA, et al. bioRxiv 2020.10.17.344069; doi: https://doi.org/10.1101/2020.10.17.344069
|
|
DV3089 |
C. elegans |
rheb-1(re64[mKate2::3xFlag::rheb-1]) III. Show Description
mKate tag inserted at 5' end of endogenous rheb-1 locus. Ubiquitous expression.
|
|
DV3285 |
C. elegans |
his-72(cp76[mNeonGreen::3xFlag::his-72]) mpk-1(re172[mpk-1::mKate2::3xFlag]) III. Show Description
Green nuclei and ubiquitous cytosolic red expression, typically excluded from nuclei but with activity-dependent translocation into nuclei. Derived in an N2 background.
C-terminally tagged mpk-1 is detectable by triplex PCR:
mpk-1 genotyping FW: ACCAAAACAACCATGGGCTCG
mpk-1 genotyping RV-1: GCTCCAAGTATGGGTGAGCC
mpk-1 genotyping RV-2: GGTTCCCTCGTATGGCTTTCC
Reference: Neal R, et al. (2021). Nuclear translocation of tagged endogenous ERK/MPK-1 MAP Kinase denotes a subset of activation events in C. elegans development.
|
|
DV3312 |
C. elegans |
rgl-1(re179[mNeonGreen::3xFlag::rgl-1]) X. Show Description
Ubiquitous expression with cytosolic localization. Derived in an N2 background.
Detection with triplex primers:
HS125 5-CTTGTCACTGTAAGGGAAGATTTCC-3
HS126 5-TTGTCCTCCTCTCCCTTGG-3
HS127 5 ACGTAGAATGTTCCAGAGTTCCAG-3'
Reference: Shin H, et al. Cell Rep. 2018 Sep 4;24(10):2669-2681. PMID: 30184501
|
|
DV3327 |
C. elegans |
pmk-1(re170[pmk-1::mNG::3xFlag]) IV. Show Description
mNeonGreen and 3xFlag tag inserted at 3' end of endogenous pmk-1 locus. Fluorescent green signal detected in both cytosol and nuclei of all somatic cells; might be silenced in the germ line. Generated in an N2 background. Reference: Shin H, et al. Cell Rep. 2018 Sep 4;24(10):2669-2681. PMID: 30184501
|
|
DV3402 |
C. elegans |
ral-1(re218[mKate2::3xFlag::ral-1]) III. Show Description
Ubiquitous expression and localization to plasma membranes. Derived in an N2 background.
TD185 5 -GCCGGAAGAGTGATGAACCC- 3
TD186 5 -TAATGAGCTCGGAGACCATGGC- 3
TD187 5 -CGCACCTCATCATACATGAACTGC- 3
Reference: Shin H, et al. Cell Rep. 2018 Sep 4;24(10):2669-2681. PMID: 30184501
|
|