| CP217 |
C. briggsae |
Cbr-msrp-1(nm86) nmDf3 I; mfIs29. Show Description
mfIs29 [Cel-lip-1::GFP + Cel-myo-2::GFP]. Strong GFP expression in pharynx and weak GFP expression in various somatic and germline tissues. nmDf3 is an 8411 bp deletion that removes Cbr-msrp-2, Cbr-msrp-3, Cbr-msrp-4, Cbr-msrp-6, and Cbr-msrp-6. Removal of all six Cbr-msrp paralogs has no apparent reproductive phenotypes. [NOTE: Van Goor J, et al. (2005) incorrectly described the nmDf3 as a 5807 bp deletion.] To confirm presence of nm86 mutation, use primers AT130+AT131 (WT: 184 nt, nm86: 224 nt).
AT130: CGAAATAATTGAACCTACCAAGA.
AT131: CACTCTCTCTGACTGCAAACG. To confirm presence of deletion, use primers AT72+AT73 (WT: 11213 nt, nmDf3: 2802) and AT20+AT75 (WT: 855 nt, nmDf3: no product). AT72: GTACGACGGATAGAGTGTGAT. AT73: CTGTGGGATTATGAAAAGACTC. AT20: AAAAGTAAAACATACCGATCACA. AT75: CAGCAGCAACCTTAGAACAT. Reference: Van Goor J, et al. Curr Biol. 2025 35:1-7.
|
|
| CQ757 |
C. elegans |
wqIs7. Show Description
wqIs7 [rgef-1p::his-58::GFP]. Pan-neuronal expression of nuclear-localized GFP. Can be used for single-nucleus RNA sequencing of neurons. Reference: St Ange J, et al. Cell Genom. 2024 Dec 11;4(12):100720. doi: 10.1016/j.xgen.2024.100720. PMID: 39637862.
|
|
| CS211 |
C. elegans |
sma-3(wk30) III; him-5(e1490) V; qcEx53. Show Description
qcEx53 [vha-6p::GFP::sma-3 + rol-6(su1006)]. Sma. Rollers. Pick rollers to maintain. Reference: Wang J, Tokarz R, Savage-Dunn C. Development. 2002 Nov;129(21):4989-98.
|
|
| CS389 |
C. elegans |
adt-2(wk156) X. Show Description
Sma. Reference: Fernando T, et al. Dev Biol. 2011 Apr 1;352(1):92-103.
|
|
| CT11 |
C. elegans |
hbl-1(mg285) X. Show Description
Egl. Slightly Pvl.
|
|
| CU6102 |
C. elegans |
skr-1(sm151) I; unc-76(e911) V. Show Description
sm151 is a semi-dominant allele of skr-1. Maintain under normal conditions. Reference: Killian DJ, et al. (2008) Dev Biol. 322(2):322-31.
|
|
| CU7905 |
C. elegans |
smIs350 IV; unc-76(e911) V. Show Description
smIs350 [hsp-16::mCherry-NLS + tra-2::FLAG(3x) + unc-76(+)] IV. Some sterility. Maintain under normal conditions. Reference: Mapes J, et al. (2010) PNAS In press.
|
|
| CU9087 |
C. elegans |
unc-76(e911) V; smIs380. Show Description
smIs380 [tra-2::GFP + unc-76(+)]. Some sterility. Maintain under normal conditions. Reference: Mapes J, et al. (2010) PNAS In press.
|
|
| CV203 |
C. elegans |
rjSi1 II. Show Description
rjSi1 [cra-1p::cra-1::GFP::cra-1 3'UTR + Cbr-unc-119(+)] II. Single copy insertion. cra-1 promoter, cra-1::GFP and 3'UTR was cloned into pCFJ150 (ttTi5605) vector and inserted into ttTi5605 of EG4322 strain. Outcrossed three times to N2 Bristol; could still carry unc-119(ed9) in the background. Superficially wild-type. This CRA-1::GFP fusion construct has been shown to be functional and its localization reflects endogenous CRA-1 localization. rjSi1 transgene can rescue synapsis defects of cra-1 mutants and restore cross-over events (six bivalents instead of the 11 to 12 univalents characteristic of cra-1 mutants). Brood size and embryonic lethality were significantly, albeit not completely, restored in the rescued line suggesting that the GFP tag might affect other CRA-1 functions. Reference: Gao J, et al. PLOS Genetics 11(3): e1005029. https://doi.org/10.1371/journal.pgen.1005029
|
|
| CV385 |
C. elegans |
acer-1(rj15) II. Show Description
acer-1(rj15) is a 7 nt deletion (removes nt 35-41 from the start codon) resulting in an out-of-frame deletion. Increased histone acetylation. Reference: Gao J, et al., PLoS Genet. 2015 Mar 13;11(3):e1005029.
|
|
| CV391 |
C. elegans |
cra-1(tm2144) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III); acer-1(rj15) II. Show Description
acer-1(rj15) is a 7 nt deletion (removes nt 35-41 from the start codon) resulting in an out-of-frame deletion and increased histone acetylation. cra-1(tm2144) is a homozygous lethal deletion balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP tm2144 homozygotes. Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Reference: Gao J, et al., PLoS Genet. 2015 Mar 13;11(3):e1005029.
|
|
| CX13111 |
C. elegans |
dop-5(ok568) V. Show Description
Derived by outcrossing RB785 three times to N2. Reference: Flavell SW, et al. Cell. 2013 Aug 29;154(5):1023-35.
|
|
| CX4103 |
C. elegans |
kyIs150 IV; sax-1(ky491) X. Show Description
kyIs150 [tax-2(delta)::GFP + lin-15(+)]. sax-1 is temperature-sensitive. ky491 was isolated by PCR from a deletion library. [NOTE: (12/29/2020) This strain has been found to actually be carrying the ky491 deletion allele of sax-1, not the ky211 point mutation as previously reported.] ky491 is a 1263 bp deletion in sax-1 (left flanking sequence: atgaagcccagg
ctgtgaataaattgaatg, right flanking sequence: ccaatcacagtcagcctccgataaaatgtc). Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
| CY573 |
C. elegans |
bvIs5. Show Description
bvIs5 [cyp-35B1p::GFP + gcy-7p::GFP]. Little or no GFP expression in adults. GFP expressed in intestine of dauers. Reference: Iser WB, et al. PLoS One. 2011 Mar 9;6(3):e17369.
|
|
| CY577 |
C. elegans |
bvIs6. Show Description
bvIs6 [cat-4p::GFP + gcy-7p::GFP]. GFP localized to intestine, neurons and hypodermis in adults. GFP localized to neurons and seam cells in dauers. Reference: Iser WB, et al. PLoS One. 2011 Mar 9;6(3):e17369.
|
|
| CYA11 |
C. elegans |
ldrIs1; eeeIs1. Show Description
ldrIs1 [dhs-3p::dhs-3::GFP + unc-76(+)]. eeeIs1 [unc-54p::Htt513(Q15)::YFP::unc-45 3'UTR]. Derived by crossing parental strains LIU1 and EAK102. YFP is fused to a fragment of mutant human Huntingtin protein; expression in body wall muscle cells. dhs-3::GFP is expressed mainly in intestinal cells and localized to intestinal lipid droplets.
|
|
| CYA19 |
C. elegans |
dvIs19 III; rexEx11. Show Description
dvIs19 [gst-4p::GFP::NLS] III. rexEx11 [hsp-16p::halo::TEV::Keap1 + mec-7p::mRFP]. Pick RFP+ worms to maintain. Constitutive red fluorescence in touch-receptor neurons. Heat shock induces expression of Halo::TEV::Keap1 protein. Oxidative stress induces expression of GFP. Superficially wild-type.
|
|
| CZ13799 |
C. elegans |
juIs76 II. Show Description
juIs76 [unc-25p::GFP + lin-15(+)] II. GFP expression in GABAergic motor neurons. [NOTE: (10/11/2018) CZ13799 was sent as a replacement for CZ1200, which was found to carry background mutations affecting neuron morphology.] Derived by outcrossing CZ1200 to remove lin-15(n765) and unidentified background mutations. Reference (for original juIs76 strain): Huang X, et al. Neuron. 2002 May 16;34(4):563-76.
|
|
| CZ13896 |
C. elegans |
juIs319. Show Description
juIs319 [col-19p::GCaMP3 + col-19p::tdTomato]. col-19p::GCaMP3 expression is induced by either laser or needle wounding. col-19 is an adult-specific collagen and is not expressed until the end of the L4 larval stage. Reference: Xu S & Chisholm AD. Curr Biol. 2011 Dec 6;21(23):1960-7.
|
|
| CZ14748 |
C. elegans |
juIs352. Show Description
juIs352 [col-19p::GFP::moesin]. GFP::moesin expression labels F-actin by fusing GFP to sequences that encoded the C-terminal end of the sole Drosophila MER homolog, moesin. The F-actin ring (GFP::moesin) is induced upon needle wounding. Reference: Xu S & Chisholm AD. Curr Biol. 2011 Dec 6;21(23):1960-7.
|
|
| CZ16518 |
C. elegans |
juEx4796. Show Description
juEx4796 [col-19p::mito::GFP + ttx-3p::RFP]. Pick animals with red fluorescence to maintain array. Transgenic animals express mito::GFP in the hypodermis. Reference: Fu H, et al. Nat Commun. 2020 Feb 26;11(1):1050. PMID: 32103012.
|
|
| CZ17515 |
C. elegans |
juSi94 II; rps-18(ok3353) IV. Show Description
juSi94 [GFP11::rps-18 + Cbr-unc-119(+)] II. Superficially wild-type. No fluorescence; carries only one portion of a split GFP reporter for visualization of ribosomes. Allows inducible GFP fluorescence of ribosomes when combined with GFP1-10 expression in tissue of choice. Reference: Noma et al Elife. 2017 Aug 2;6. pii: e26376. doi: 10.7554/eLife.26376.
|
|
| CZ18018 |
C. elegans |
juSi94 II; rps-18(ok3353) IV; juEx5375. Show Description
juSi94 [rps-18p::GFP11::rps-18 + Cbr-unc-119(+)] II. juEx5375 [col-19p::GFP1-10 + ttx-3p::RFP]. Pick RFP+ to maintain. Expression of split GFP reporter labels ribosomes in the epidermis. Reference: Noma K, et al. Elife. 2017 Aug 2;6:e26376. doi: 10.7554/eLife.26376.
|
|
| CZ18020 |
C. elegans |
juSi94 II; rps-18(ok3353) IV; juEx5377. Show Description
juSi94 [GFP11::rps-18 + Cbr-unc-119(+)] II. juEx5377 [myo-3p::GFP1-10 + ttx-3p::RFP]. Pick ttx-3::RFP to maintain. Muscle-specific expression of split GFP reporter allows visualization of ribosomes in muscle. Reference: Noma et al Elife. 2017 Aug 2;6. pii: e26376. doi: 10.7554/eLife.26376.
|
|
| CZ18412 |
C. elegans |
juSi94 II; rps-18(ok3353) IV; glo-4(ok623) V; juEx5515. Show Description
juSi94 [GFP11::rps-18 + Cbr-unc-119(+)] II. juEx5515 [unc-25p::GFP1-10 + unc-25p::mCherry::rab-3 + ttx-3p::RFP]. Pick ttx-3::RFP to maintain. GABAergic motor neuron-specific expression of split GFP reporter allows visualization of ribosomes in neurons, and GABAergic motor neuron-specific expression of mCherry::rab-3. Reference: Noma et al Elife. 2017 Aug 2;6. pii: e26376. doi: 10.7554/eLife.26376.
|
|
| CZ19297 |
C. elegans |
juSi94 II; rps-18(ok3353) juIs409 IV. Show Description
juSi94 [GFP11::rps-18 + Cbr-unc-119(+)] II. juIs409 [rgef-1p::GFP1-10 + ttx-3p::RFP] IV. Pan-neuronal-specific expression of split GFP reporter allows visualization of ribosomes in neurons. Reference: Noma et al Elife. 2017 Aug 2;6. pii: e26376. doi: 10.7554/eLife.26376.
|
|
| CZ19299 |
C. elegans |
juSi94 juIs438 II; rps-18(ok3353) IV. Show Description
juIs438 [mec-4p::GFP1-10 + mec-4p::tagRFP] II. juSi94 [rps-18p::GFP11::rps-18]. Expression of split GFP reporter labels ribosomes in touch neurons. Generated in N2 background. Reference: Noma et al Elife. 2017 Aug 2;6. pii: e26376. doi: 10.7554/eLife.26376.
|
|
| CZ20132 |
C. elegans |
juSi94 II; rps-18(ok3353) IV; juIs463. Show Description
juSi94 [GFP11::rps-18 + Cbr-unc-119(+)] II. juIs463 [flp-13p::GFP1-10 + ttx-3p::RFP]. DD motor neuron-specific expression of split GFP reporter allows visualization of ribosomes in those neurons. Reference: Noma et al Elife. 2017 Aug 2;6. pii: e26376. doi: 10.7554/eLife.26376.
|
|
| CZ22698 |
C. elegans |
juEx6911. Show Description
juEx6911 [unc-25p::PH::miniSOG(Q103L) + unc-25p::mCherry + ttx-3::GFP]. Pick GFP+ to maintain. Expression of mCherry and PH-miniSOG (mini Singlet Oxygen Generator) in GABAergic motor neurons. Reference: Xu S & Chisholm AD. Sci Rep. 2016 Feb 10;6:21271.
|
|
| CZ24324 |
C. elegans |
muIs32 II; qns-1(ju1563)/mIs11 IV. Show Description
muIs32 [mec-7p::GFP + lin-15(+)]. mIs11 [myo-2p::GFP + pes-10p::GFP + F22B7.9::GFP]. GFP expression in 4-cell embryos, pharyngeal muscle and gut. Heterozygotes are WT with dim GFP signal in the pharynx. mIs11 homozygotes are WT with bright GFP in the pharynx. qns-1(ju1563) animals are sterile. Pick WT with dim GFP+ in pharynx to maintain. mIs11 homozygotes will quickly overtake the population if not selected against. Reference: Kim KW, et al. Elife. 2018 Nov 21;7:e39756. doi: 10.7554/eLife.39756. PMID: 30461420
|
|
| CZ25417 |
C. elegans |
prde-1(ju1534[GFP::loxP::3xFlag::prde-1]) V. Show Description
GFP and 3xFlag tags inserted into endogenous lat-1 locus. Reference: Kim KW, et al. Neuron. 2018 Feb 7;97(3):511-519.e6. doi: 10.1016/j.neuron.2018.01.014. PMID: 29395906.
|
|
| CZ25708 |
C. elegans |
prg-1(ju1574) I. Show Description
Temperature sensitive sterility: maintain at 15-20C. prg-1(ju1574) mutant animals become sterile at the fifth generation grown at 25C. prg-1(ju1574) contains two mutations in the PIWI domain active site (RNaseH/slicer) [D583A, Y585A]. Mutation of the first conserved aspartate of the catalytic triad (D-D-H motif) to alanine (D583A) created an A-D-H motif which abolishes slicer activity in Argonaute proteins. WT:
[GTCGGCTACGATCTGTACCACGACTCGACATTGAAAGGAAAAACT --> VGYDLYHDSTLKGKT] ju1574: [GTCGGCTACGcgCTGgctCAtGAtTCGACATTGAAAGGAAAAACT --> CGYALAHDSTLKGKT] Forward genotyping primer:
GTAATGCTCGCTGACGACAA Reverse genotyping primer: TTGACGAACTGTGGAACCAA Reference: Kim KW, et al. Neuron. 2018 Feb 7;97(3):511-519.e6. doi: 10.1016/j.neuron.2018.01.014.
|
|
| CZ2611 |
C. elegans |
vab-2(ju1) efn-2(ev658) IV; efn-3(ev696) X. Show Description
vab-2(ju1) has embryonic lethality (12%) and notched heads (about 40%). vab-2(ju1) is considered a null allele (W30opal), and was previously called efn-1. Vab, embryonic ventral enclosure defects, male ray fusions.
|
|
| CZ3011 |
C. elegans |
unc-16(ju146) III. Show Description
Uncoordinated and egg-laying defective. T to C transition resulting in L75P.
|
|
| CZ4111 |
C. elegans |
vab-2(ju1) IV. Show Description
vab-2(ju1) has embryonic lethality (12%) and notched heads (about 40%). vab-2(ju1) is considered a null allele (W30opal). pka efn-1.
|
|
| CZ5847 |
C. elegans |
spon-1(ju402) II; juEx1111. Show Description
juEx1111 [spon-1::vGFP + ttx-3p::RFP]; rescues ju402 lethality. Vab. 2-fold Lpy. ju402 is lethal. Reference: Woo WM, et al. Development. 2008 Aug;135(16):2747-56.
|
|
| CZ9236 |
C. elegans |
juIs252 V. Show Description
juIs252 [mec-4p::mCherry + ttx-3p::RFP] V. mCherry expression in touch neurons. Reference: Knowlton WM, et al. Front Neurosci. 2017 May 10;11:263. doi: 10.3389/fnins.2017.00263. Chuang M, et al. 2014 Cell Rep, 9, 874-83.
|
|
| CZ9957 |
C. elegans |
gtl-2(n2618) IV. Show Description
Maintain under normal conditions. Reference: Stawicki TM, et al. Curr Biol. 2011 May 24;21(10):883-8.
|
|
| DA1077 |
C. elegans |
egl-30(ad810) dpy-5(e61)/szT1 [lon-2(e678)] I; +/szT1 X. Show Description
ad810 is homozygous lethal. ad810/+ is Egl and it suppresses gpb-2 (a.k.a. eat-11). In DA1077, heterozygotes are Egl. Strain throws Lon Males.
|
|
| DA1084 |
C. elegans |
egl-30(ad806) I. Show Description
Egl. Semi-dominant suppressor of eat-11.
|
|
| DA1096 |
C. elegans |
egl-30(ad810)/szT1 [lon-2(e678)] I; +/szT1 X. Show Description
ad810 is homozygous lethal. ad810/+ is Egl and it suppresses gpb-2 (a.k.a. eat-11). In DA1096, heterozygotes are Egl. Throws Lon males.
|
|
| DA1648 |
C. elegans |
lin-15B&lin-15A(n765) X; adEx1648. Show Description
adEx1648 [F01E11.5::GFP + lin-15(+)]. Maintain by picking non-Muv. n765 is temperature-sensitive.
|
|
| DA2211 |
Escherichia coli |
E. coli. Show Description
Bacteria. E18 eat-4 promoter/GFP translational fusion, fused Klenowed ScaI/PstI fragments of pRE4-4-YK-Sac_Pst (~4.4kb) with TU#62(~2.2kb), checked loss of PstI site. PKA pRE4-GFP. Biosafety Level: BSL-1.
|
|
| DA2250 |
C. elegans |
mgl-2(tm355) I; mgl-1(tm1811) X. Show Description
Superficially wild-type; multiple subtle phenotypes related to nutritional response. References: Kang C, You YJ, Avery L. Genes Dev. 2007 Sep 1;21(17):2161-71. Kang C, Avery L. Genes Dev. 2009 Jan 1;23(1):12-7.
|
|
| DA438 |
C. elegans |
bli-4(e937) I; rol-6(e187) II; daf-2(e1368) vab-7(e1562) III; unc-31(e928) IV; dpy-11(e224) V; lon-2(e678) X. Show Description
Linkage mapping strain. Maintain at 15C.
|
|
| DA493 |
C. elegans |
phm-3(ad493) III. Show Description
Weak pharyngeal birefringence. DA493 carries the fln-2(ot611) mutation, described in DOI: 10.1038/s41467-019-13062-z (D. Gems lab).
|
|
| DA531 |
C. elegans |
eat-1(ad427) IV. Show Description
Abnormal feeding. Slow pumping. DA531 carries the fln-2(ot611) mutation, described in DOI: 10.1038/s41467-019-13062-z (D. Gems lab).
|
|
| DA541 |
C. elegans |
gpb-2(ad541) I. Show Description
Abnormal feeding. Slippery Corpus. Long. Slight coiler Unc. gpb-2(ad541) previously called eat-11(ad541).
|
|
| DA686 |
C. elegans |
nDf16/qC1 [dpy-19(e1259) glp-1(q339)] III. Show Description
Heterozygotes are WT and segregate WT, DpySteriles and dead eggs. dpy-19(e1259) is temperature sensitive. Maintain by picking WT. [Checked 11/94 with sma-3 and nDf16 is present.]
|
|
| DA709 |
C. elegans |
+/nT1 IV; sqt-3(sc63) eat-6(ad467) unc-76(e911)/nT1 V. Show Description
Heterozygotes are WT and segregate WT, Vul and Sqt Unc larvae that grow very slowly.
|
|