Search Strains

GFP and 3xFlag tag inserted in endogenous dmd-3 locus using the CRISPR SEC cassette (Dickinson 2015). sgRNA: accctttcagccgtattgt Insertion site: V: 19650564-19650565. Reference: Pereira L, et al. Elife. 2019 Jan 1;8. pii: e42078. doi: 10.7554/eLife.42078.

C09C7.1 Deletion breakpoints at position 237 and 803 with insertion of CTTGTATAGCAAGAAACC at this breakpoint. Predicted molecular null. About 30% penetrance of displaced axons in the ventral nerve cord. Homozygous viable.

otEx7353 [UPN::tagRFP::TRA-1(active) + rol-6(su1006)]. Rollers. Pick Rollers to maintain. Nervous system-specific expression of a TRA-1 gain-of-function construct. UPN is a concatenated panneuronal promoter (containing promoter fragments from unc-11, rgef-1, ehs-1, and ric-19). TRA-1(active) is a shortened version of the TRA-1A cDNA (860aa) predicted to encode the proteolytically activated version of TRA-1A generated by C-terminal cleavage in hermaphrodites (Schvarzstein and Spence 2006).

GFP tag inserted at the C-terminus of the endogenous pha-4 locus by CRISPR. Allele obtained using Cas9-sgRNA ribonucleoprotein complex, following Dokshin et al, 2018 method. Please contact Oliver Hobert prior to publishing work using this strain.

CRISPR-engineered deletion in dmd-4(ot935[dmd-4::GFP]) removing +3201 to +3710 relative to start codon. Partial removal of intron 3 results in loss of somatic nervous system expression without affecting pharyngeal expression.

Superficially wild-type. GFP inserted into endogenous exc-7 locus by CRISPR/Cas9. Reference: Pham K & Hobert O. MicroPubl Biol. 2019; 2019: 10.17912/micropub.biology.000189.

CRISPR allele of daf-16, tagged at the C-terminus with GFP. Reference: Aghayeva U, et al. A panel of fluorophore-tagged daf-16 alleles. microPublication Biology.

CRISPR allele of daf-16, tagged at the C-terminus with mNeptune2.5::AID*. Reference: Aghayeva U, et al. MicroPubl Biol. 2020 Jan 7;2020:10.17912/micropub.biology.000210. doi: 10.17912/micropub.biology.000210. PMID: 32550509

GFP tag inserted at the C-terminus of the endogenous unc-42 locus by CRISPR. Allele generated by SUNY Biotech. Reference: Berghoff EG, et al. Elife. 2021 Jun 24;10:e64903. doi: 10.7554/eLife.64903. PMID: 34165428

GFP tag inserted at the C-terminus of the endogenous ceh-44 locus by CRISPR. Allele obtained using Cas9-sgRNA ribonucleoprotein complex, following Dokshin et al, 2018 method.

GFP tag inserted at the C-terminus of the endogenous ceh-49 locus by CRISPR. Allele obtained using Cas9-sgRNA ribonucleoprotein complex, following Dokshin et al, 2018 method.

otEx7476 [ceh-34(fosmid) + myo-3p::mCherry]. Pick mCherry+ to maintain. ot1014 is a CRISPR/Cas9-engineered allele removing the entire ceh-34 locus. ot1014 homozygotes arrest as L1 larvae. Reference: The enteric nervous system of C. elegans is specified by the Sine Oculis-like homeobox gene ceh-34. Vidal B, et al. bioRxiv 2021.11.30.470650; doi: https://doi.org/10.1101/2021.11.30.470650

CRISPR/Cas9 engineered deletion of full cdh-1 locus.

CRISPR/Cas9 engineered deletion of full cdh-3 locus.

ot1065 is a CRISPR/Cas9-engineered allele removing the entire ceh-45 locus. Reference: Vidal B, et al. bioRxiv 2021.11.30.470650; doi: https://doi.org/10.1101/2021.11.30.470650

otIs785 [ceh-34p::GFP::CLA-1 + ceh-34p::TagRFP + rol-6(su1006)]. Rollers. Reference: The enteric nervous system of C. elegans is specified by the Sine Oculis-like homeobox gene ceh-34. Vidal B, et al. bioRxiv 2021.11.30.470650; doi: https://doi.org/10.1101/2021.11.30.470650

CRISPR/Cas9 engineered deletion of full casy-1 locus.

CRISPR/Cas9 engineered deletion of full cdh-8 locus.

CRISPR/Cas9 engineered deletion of full fmi-1 locus.

CRISPR/Cas9 engineered deletion of full cdh-12 locus.

otIs810 [sto-3p::tagRFP + sto-3p::GFP::cla-1]. Reference: Reilly MB, et al. Widespread employment of conserved C. elegans homeobox genes in neuronal identity specification. bioRxiv 2022.04.29.490095; doi: https://doi.org/10.1101/2022.04.29.490095

GFP tag inserted at the C-terminus of the endogenous ceh-48 locus by CRISPR. Allele obtained using Cas9-sgRNA ribonucleoprotein complex, following Dokshin et al, 2018 method. Reference: Leyva-Diaz E & Hobert O. Current Biol. 2022 Mar 3;S0960-9822(22)00262-7. PMID: 35259341

dzIs89 [inx-1p::BirA::nrx-1 + gcy-13p::AP::nlg-1 + gcy-13p::tagBFP + unc-122p::stretavadin::tagRFP] X. cdh-5(ot1093) is a CRISPR/Cas9 engineered deletion of full cdh-5 locus. Reference: Majeed M, et al. Sci Adv. 2025 Feb 21;11(8):eads2852. doi: 10.1126/sciadv.ads2852. PMID: 39983000.

unc-86(ot1158) is a CRISPR-engineered null allele removing the entire unc-86 coding region. Very slightly Unc. The repair ssODN is TCTGTCTCCTCCCAGCTTCAAGGTCCCCCTCTTTTACCTTGATTCTTTGATTAGTTTCGTTTTCGTGAAC, and the two sgRNAs are acaacatacaatgggctacc (start) caaggtccccctcttttcca (end). References: Cros C & Hobert O. bioRxiv 2022.04.19.488792; doi: https://doi.org/10.1101/2022.04.19.488792. Reilly MB, et al. bioRxiv 2022.04.29.490095; doi: https://doi.org/10.1101/2022.04.29.490095.

CRISPR/Cas9 engineered tagged endogenous locus. Him. See description of strain OH15262 for full description of otIs669 NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene (Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642). Reference: Cros C & Hobert O. bioRxiv 2022.04.19.488792; doi: https://doi.org/10.1101/2022.04.19.488792.

otSi2 [ges-1p::TIR1(F79G)::mRuby::unc-54 3'UTR + Cbr-unc-119(+) *ieSi61] II. Temperature-senstive daf(c): maintain at 15C. Intestine-specific TIR1 sequence in ieSi61 allele was edited to TIR1(F79G) using CRISPR/Cas9 to make it compatible with AID2. [TCC GTC GAG CTC AAG GGA AAG CCA CAC TTC] edited to [AGT GTC GAA TTG AAG GGA AAG CCA CAC GGA]. This strain can be used to deplete DAF-16 specifically from the intestine with the modified auxin 5-Ph-IAA. Constitutive dauer formation at 25 C due to daf-2(e1370). Reference: Sural S, et al. Sci Adv. 2025 Sep 26;11(39):eadw1270. doi: 10.1126/sciadv.adw1270. PMID: 40991693.

ot1193 is a CRISPR-engineered mutation of a small unc-39 auto-regulatory region containing a cluster of several predicted homeodomain binding sites in the endogenously-tagged unc-39(syb4537) reporter strain. Reference: Cros C & Hobert O. bioRxiv 2022.04.19.488792; doi: https://doi.org/10.1101/2022.04.19.488792.

CRISPR/Cas9 engineered tagged endogenous locus. Him. See description of strain OH15262 for full description of otIs669 NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene (Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642). Reference: Reilly MB, et al. Widespread employment of conserved C. elegans homeobox genes in neuronal identity specification. bioRxiv 2022.04.29.490095; doi: https://doi.org/10.1101/2022.04.29.490095

CRISPR/Cas9 engineered tagged endogenous locus. Him. See description of strain OH15262 for full description of otIs669 NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene (Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642). Reference: Reilly MB, et al. PLoS Genet. 2022 Sep 30;18(9):e1010372. doi: 10.1371/journal.pgen.1010372. PMID: 36178933.

CRISPR/Cas9 engineered tagged endogenous locus. Him. See description of strain OH15262 for full description of otIs669 NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene (Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642). Reference: Reilly MB, et al. Widespread employment of conserved C. elegans homeobox genes in neuronal identity specification. bioRxiv 2022.04.29.490095; doi: https://doi.org/10.1101/2022.04.29.490095

CRISPR/Cas9 engineered tagged endogenous locus. Him. See description of strain OH15262 for full description of otIs669 NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene (Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642). Reference: Reilly MB, et al. Widespread employment of conserved C. elegans homeobox genes in neuronal identity specification. bioRxiv 2022.04.29.490095; doi: https://doi.org/10.1101/2022.04.29.490095

Egl. See description of strain OH15262 for full description of otIs669 NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene (Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642). Reference: Reilly MB, et al. Widespread employment of conserved C. elegans homeobox genes in neuronal identity specification. bioRxiv 2022.04.29.490095; doi: https://doi.org/10.1101/2022.04.29.490095

Dpy Rol. Heterozygotes are Left-handed Rol. R92C mutation in Cbr-dpy-10 generated via CRISPR/Cas9. Homologous to the C. elegans dpy-10(cn64) mutation.

The Null Transcriptional Reporter (NuTR) cassette was used to remove the linc-23 locus resulting in a null allele and transcriptional reporter driving expression of GFP. The cassette contains the dominant sqt-1(e1350) allele that results in roller animals. Expression of Cre (via crossing into a strain expressing a germline Cre or by injection of a Cre transgene) will result in removal of the selectable markers and result in non-roller animals. Pick Rollers to retain full transgene cassette. GFP expression is seen in the male somatic gonad and extremely dim expression in hermaphrodite spermatheca.

The Null Transcriptional Reporter (NuTR) cassette was used to remove the linc-36 locus resulting in a null allele and transcriptional reporter driving expression of GFP. The cassette contains the dominant sqt-1(e1350) allele that results in roller animals. Expression of Cre (via crossing into a strain expressing a germline Cre or by injection of a Cre transgene) will result in removal of the selectable markers and result in non-roller animals. Pick Rollers to retain full transgene cassette. GFP expression is seen in the sperm of both hermaphrodites and males.

The Null Transcriptional Reporter (NuTR) cassette was used to remove the linc-41 locus resulting in a null allele and transcriptional reporter driving expression of GFP. The cassette contains the dominant sqt-1(e1350) allele that results in roller animals. Expression of Cre (via crossing into a strain expressing a germline Cre or by injection of a Cre transgene) will result in removal of the selectable markers and result in non-roller animals. Pick Rollers to retain full transgene cassette. GFP expression is seen in the male somatic gonad, spermatheca of hermaphrodites, as well as several other tissues in the head.

otIs879 [sri-1p::NLS::GFP + pha-1(+)]. Reference: Reilly MB, et al. Widespread employment of conserved C. elegans homeobox genes in neuronal identity specification. bioRxiv 2022.04.29.490095; doi: https://doi.org/10.1101/2022.04.29.490095

CRISPR/Cas9 engineered deletion of full cdh-4 locus.

CRISPR/Cas9 engineered deletion of full cdh-9 locus.

CRISPR-engineered mutation of CUT transcription factor binding site in endogenously-tagged rab-3(syb3072[rab-3::T2A::3xNLS::GFP]). Causes a reduction in rab-3 expression. Reference: Leyva-Diaz E & Hobert O. Current Biol. 2022 Mar 3;S0960-9822(22)00262-7. PMID: 35259341

CRISPR/Cas9 engineered tagged endogenous locus. Him. See description of strain OH15262 for full description of otIs669 NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene (Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642). Reference: Cros C & Hobert O. bioRxiv 2022.04.19.488792; doi: https://doi.org/10.1101/2022.04.19.488792.

GFP tag inserted at the C-terminus of the endogenous nlp-66 locus by CRISPR. Allele generated by SUNY Biotech. See description of strain OH15262 for full description of otIs669 NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene (Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642). Reference: Reilly MB, et al. bioRxiv 2022.04.29.490095; doi: https://doi.org/10.1101/2022.04.29.490095

ot1264 is a CRISPR deletion removing -10.8 kb to -1.8 kb before the first exon of ttx-1, made in the context of the ttx-1::GFP allele syb1679. Notably ttx-1 expression in RIB is lost, and RIB markers are off or dim. Reference: Reilly MB, et al. Widespread employment of conserved C. elegans homeobox genes in neuronal identity specification. bioRxiv 2022.04.29.490095; doi: https://doi.org/10.1101/2022.04.29.490095

ot1015 is a GFP tag inserted at the C-terminus of the endogenous ceh-44 locus by CRISPR. ot1294 is a deletion removing intron 7 from the endogenously-tagged ceh-44 locus, which also removes the UNC-75 binding site. No pan-neuronal nuclear GFP expression. Please contact Oliver Hobert prior to publishing work using this strain.

Full gene deletion of the lim-6 locus (-51 to +5144) by CRISPR. Please contact Oliver Hobert prior to publishing work using this strain.

ot1015 is a GFP tag inserted at the C-terminus of the endogenous ceh-44 locus by CRISPR. ot1402 is a deletion removing the UNC-75 binding site within intron 7 of the endogenously-tagged ceh-44 locus. Reduced pan-neuronal nuclear CEH-44::GFP expression. Please contact Oliver Hobert prior to publishing work using this strain.

Derived by CRISPR edit of spig-2(syb6670[spig-2::SL2::GFP::H2B]) in parental strain PHX6670 to insert T2A was inserted between GFP and H2B to convert the reporter from nuclear to cytoplasmic localization. Reference: Aguilar GR & Hobert O. (2024). A protocol to transform a fluorescent reporter from a nuclear to a cytoplasmic location. microPublication Biology. https://doi.org/10.17912/micropub.biology.000954

ot1326 is CRISPR-engineered 2,029 bp deletion removing the entire ins-18 coding region. Sequence after edit: AGCTCATTTTAATTTAACACAATGGTCCACCGACTACGTGGAAGATCTTCTTGCCTACTGTGCCCCAATT. Reference: Sural S, et al. Sci Adv. 2025 Sep 26;11(39):eadw1270. doi: 10.1126/sciadv.adw1270. PMID: 40991693.

CRISPR/Cas9 engineered tagged endogenous locus. Him. See description of strain OH15262 for full description of otIs669 NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene. Reference: Fernandez RW, et al. Development. 2025 Aug 15;152(16):dev204958. doi: 10.1242/dev.204958. PMID: 40838983.

GFP tag inserted at the N-terminus of the endogenous cone-1 locus by CRISPR. ot1015 is a GFP tag inserted at the C-terminus of the endogenous ceh-44 locus by CRISPR. ot1294 is a deletion removing intron 7 from the endogenously-tagged ceh-44 locus, which also removes the UNC-75 binding site. Normally broad, punctate expression of GFP::CEH-44 is not present. Please contact Oliver Hobert prior to publishing work using this strain.