Strain Information
| Name | OH17241 View On Wormbase |
|---|---|
| Species | C elegans |
| Genotype | unc-86(ot1158) III. |
| Description | unc-86(ot1158) is a CRISPR-engineered null allele removing the entire unc-86 coding region. Very slightly Unc. The repair ssODN isTCTGTCTCCTCCCAGCTTCAAGGTCCCCCTCTTTTACCTTGATTCTTTGATTAGTTTCGT TTTCGTGAAC, and the two sgRNAs are acaacatacaatgggctacc (start) caaggtccccctcttttcca (end). References: Cros C & Hobert O. bioRxiv 2022.04.19.488792; doi: https://doi.org/10.1101/2022.04.19.488792. Reilly MB, et al. bioRxiv 2022.04.29.490095; doi: https://doi.org/10.1101/2022.04.29.490095. |
| Mutagen | Crispr/Cas9 |
| Outcrossed | x2 |
| Made by | Tessa Tekieli |
| Laboratory | OH |
| Reference | bioRxiv 2022.04.29.490095; doi: https://doi.org/10.1101/2022.04.29.490095 |
Sign in
or
register an account if you want to order this strain.