More Fields
Strain Species Genotype
VC1583 C. elegans cdh-1(gk747) III. Show Description
R10F2.1. External left primer: GAGGTTCTCACCTGCTCTGG. External right primer: ACGAGCTGGATTCGCTTAAA. Internal left primer: GGCGAGGAATCCTAACATGA. Internal right primer: AAACGACAAGCAGTGGCTCT. Internal WT amplicon: 1931 bp. Deletion size: 1004 bp. Deletion left flank: AGAAGCCGAGAAATGAAATGAAATTTAGGTAGAAGGGCCCTGATGTGTGTGTGTGTGTG TGTGTGTGTGTGTGTGTGTGTGTGTG. Deletion right flank: AGAGTTTGGGCTTATTTTTTGAAATTTTCC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1658 C. elegans cdh-1(gk784) III. Show Description
R10F2.1. External left primer: GAGGTTCTCACCTGCTCTGG. External right primer: ACGAGCTGGATTCGCTTAAA. Internal left primer: GGCGAGGAATCCTAACATGA. Internal right primer: AAACGACAAGCAGTGGCTCT. Internal WT amplicon: 1931 bp. Deletion size: 579 bp. Deletion left flank: AGAAGCCGAGAAATGAAATGAAATTTAGGT. Deletion right flank: TTGGGGGTAGATTTACTGAGGATATTGTAG. Insertion Sequence: T. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
OH16445 C. elegans cdh-1(ot1034) III. Show Description
CRISPR/Cas9 engineered deletion of full cdh-1 locus.
OH16774 C. elegans cdh-1(ot1092[cdh-1::T2A::GFP::H2B]) III. Show Description
SL2::GFP::H2B tag inserted at C-terminus of endogenous cdh-1 locus.
VC1011 C. elegans acdh-1(ok1489) I. Show Description
C55B7.4. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1087 C. elegans acdh-1(ok1514) I. Show Description
C55B7.4. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
DMS303 C. elegans nIs590 V. Show Description
nIs590 [fat-7p::fat-7::GFP + lin15(+)] V.  Derived by X-ray integration of waEx15. The fat-7::fat-7::GFP translational reporter is activated by 15C or acdh-11 loss-of-function. See Ma et al., Cell. 2015 May 21; 161(5): 1152–1163.
DMS441 C. elegans acdh-11(n5878) III; nIs590 V. Show Description
nIs590 [fat-7p::fat-7::GFP + lin15(+)] V.  The fat-7::fat-7::GFP translational reporter is activated constitutively by loss of acdh-11 function. acdh-11(n5878) is a 366 bp deletion. Reference: Ma et al., Cell. 2015 May 21; 161(5): 1152–1163.
OH16773 C. elegans cdh-12(ot1091) III. Show Description
CRISPR/Cas9 engineered deletion of full cdh-12 locus.
OH17002 C. elegans cdh-10(ot1118[cdh-10::T2A::GFP::H2B]) IV. Show Description
SL2::GFP::H2B tag inserted at C-terminus of endogenous cdh-10 locus.
OH17030 C. elegans cdh-12(ot1119[cdh-12::T2A::GFP::H2B]) III. Show Description
SL2::GFP::H2B tag inserted at C-terminus of endogenous cdh-12 locus.
RB2157 C. elegans cdh-12(ok2902) III. Show Description
Y71D11A.1 Homozygous. Outer Left Sequence: atggccgagtacaccttcac. Outer Right Sequence: ccagagtcctgagcttccac. Inner Left Sequence: attccgcaaaactccacg. Inner Right Sequence: aggatcgtaacgttcaaccg. Inner Primer PCR Length: 1102. Deletion size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2160 C. elegans cdh-10(ok2920) IV. Show Description
C45G7.5 Homozygous. Outer Left Sequence: acctcaaatccccgatcttt. Outer Right Sequence: taggccaccaacttcaatcc. Inner Left Sequence: tcaaaaaccgtggtgatcatt. Inner Right Sequence: cccactctgcagttttcaca. Inner Primer PCR Length: 1163. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC4560 C. elegans acdh-12(gk5631[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) II. Show Description
Homozygous viable. Deletion of 2565 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TGTTGAAGAGTGAGTCCTCCATTTCCACAG. Right flanking sequence: GGAGGACGGTCATTGTTATCTCTTGTAGAC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VL717 C. elegans unc-119(ed3) III; wwEx54. Show Description
wwEx54 [acdh-1p::GFP]. Maintain by picking GFP+ worms. Reference: Arda HE, et al. (2010) Mol Syst Biol 6:367.
VL749 C. elegans wwIs24. Show Description
wwIs24 [acdh-1p::GFP + unc-119(+)]. May still be carrying unc-119(ed3) in the background. References: MacNeil LT, etr al. Cell. 2013 Mar 28;153(1):240-52. Watson E, et al. Cell. 2014 Feb 13;156(4):759-70.