| OH19219 |
C. elegans |
ceh-44(ot1515[*ot1015[ceh-44::gfp]]) III. Show Description
ot1015 is a GFP tag inserted at the C-terminus of the endogenous ceh-44 locus by CRISPR. ot1434 is a deletion removing exons 5-7 from the endogenously-tagged ceh-44 locus. No pan-neuronal nuclear GFP expression. Please contact Oliver Hobert prior to publishing work using this strain.
|
|
| OH19232 |
C. elegans |
daf-16(ot853[daf-16::mNG::AID*]) I; otSi2 II. Show Description
otSi2 [ges-1p::TIR1(F79G)::mRuby::unc-54 3'UTR + Cbr-unc-119(+) *ieSi61] II. Intestine-specific TIR1 sequence in ieSi61 allele was edited to TIR1(F79G) using CRISPR/Cas9 to make it compatible with AID2. [TCC GTC GAG CTC AAG GGA AAG CCA CAC TTC] edited to [AGT GTC GAA TTG AAG GGA AAG CCA CAC GGA]. This strain can be used to deplete DAF-16 specifically from the intestine with the modified auxin 5-Ph-IAA. Reference: Sural S, et al. Sci Adv. 2025 Sep 26;11(39):eadw1270. doi: 10.1126/sciadv.adw1270. PMID: 40991693.
|
|
| OH19259 |
C. briggsae |
Cbr-unc-25(ot1524[Cbr-unc-25::SL2::mScarlet3::H2B]) III. Show Description
SL2::mScarlet3::H2B tag inserted after STOP codon of endogenous Cbr-unc-25 locus using CRISPR/Cas9. Generated in C. briggsae AF16 background. Reference: Toker IA, et al. bioRxiv 2024.11.23.624988; doi: https://doi.org/10.1101/2024.11.23.624988.
|
|
| OH19295 |
C. elegans |
unc-25(ot1536[unc-25b.1::T2A::GFP::H2B]) III; him-5(e1490) V. Show Description
CRISPR-engineered T2A::GFP::H2B insertion specifically tags isoform b.1 of the endogenous unc-25 locus. Him. Reference: Wang C, et al. Elife. 2024 Oct 18:13:RP95402. doi: 10.7554/eLife.95402. PMID: 39422452.
|
|
| OH19299 |
C elegans |
unc-75(ot1539[mScarlet-I3::unc-75]) I. Show Description
mScarlet-I3 tag inserted into endogenous unc-75 locus via CRISPR/Cas9 engineering. Reference: Cao WX, et al. (2024). bioRxiv: 2024.2006.2011.598534. https://doi.org/10.1101/2024.06.11.598534.
|
|
| OH19337 |
C. elegans |
tph-1(ot1545) II. Show Description
ot1545 is CRISPR-engineered 2,838 bp deletion removing the entire tph-1 coding region. Sequence after edit: tgtatattacgtgccgaattccagaagcaccacgcccaacacaaagacacgttttcctgcagaagaggaa. Reference: Sural S, et al. Sci Adv. 2025 Sep 26;11(39):eadw1270. doi: 10.1126/sciadv.adw1270. PMID: 40991693.
|
|
| OH19587 |
C. elegans |
php-3(syb1549[php-3::GFP]) III; otIs669 him-5(e1490) V. Show Description
CRISPR/Cas9 engineered tagged endogenous locus. Him. See description of strain OH15262 for full description of otIs669 NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene. Reference: Fernandez RW, et al. Development. 2025 Aug 15;152(16):dev204958. doi: 10.1242/dev.204958. PMID: 40838983.
|
|
| OH19735 |
C. elegans |
otIs937 V. Show Description
otIs937 [ceh-19(prom2)::daf-2(DN)::eBFP2::SL2::tagRFP-T::tbb-2 3' UTR + unc-122p::GFP::unc-54 3' UTR] V. daf-2(DN) encodes a dominant negative form of the DAF-2 protein, causing inhibition of the insulin receptor DAF-2. daf-2(DN) encodes a dominant negative form of the DAF-2 protein, causing inhibition of the insulin receptor DAF-2. ceh-19(prom2) drives expression of daf-2(DN) specifically in the MC neurons in the pharyngeal nervous system. The multicopy array was inserted at the oxTi553 landing site using the Fluorescent Landmark Interference (FLInt) method. Reference: Sural S, et al. Sci Adv. 2025 Sep 26;11(39):eadw1270. doi: 10.1126/sciadv.adw1270. PMID: 40991693.
|
|
| OH19767 |
C. elegans |
otIs942 V. Show Description
otIs942 [tph-1(prom5)::daf-2(DN)::eBFP2::SL2::tagRFP-T::tbb-2 3' UTR + unc-122p::GFP::unc-54 3' UTR] V. daf-2(DN) encodes a dominant negative form of the DAF-2 protein, causing inhibition of the insulin receptor DAF-2. daf-2(DN) encodes a dominant negative form of the DAF-2 protein, causing inhibition of the insulin receptor DAF-2. tph-1(prom5) drives expression of daf-2(DN) specifically in the NSM neurons. The multicopy array was inserted at the oxTi553 landing site using the Fluorescent Landmark Interference (FLInt) method. Reference: Sural S, et al. Sci Adv. 2025 Sep 26;11(39):eadw1270. doi: 10.1126/sciadv.adw1270. PMID: 40991693.
|
|
| OH19781 |
C. briggsae |
Cbr-cat-1(ot1621[Cbr-cat-1::SL2::mScarlet3::H2B]) X. Show Description
SL2::mScarlet3::H2B tag inserted after STOP codon of endogenous Cbr-cat-1 locus using CRISPR/Cas9. Generated in C. briggsae AF16 background. Reference: Toker IA, et al. bioRxiv 2024.11.23.624988; doi: https://doi.org/10.1101/2024.11.23.624988.
|
|
| OH19827 |
C. tropicalis |
Ctr-cat-1(ot1631[Ctr-cat-1::SL2::mScarlet3::H2B]) X. Show Description
SL2::mScarlet3::H2B tag inserted after STOP codon of endogenous Ctr-cat-1 locus using CRISPR/Cas9. Generated in C. tropicalis NIC203 background. Reference: Toker IA, et al. bioRxiv 2024.11.23.624988; doi: https://doi.org/10.1101/2024.11.23.624988.
|
|
| OH19945 |
C. elegans |
pha-4(syb5755[pha-4::3xGAS::GFP::3xGAS::AID*::TEV::LoxP::3xFLAG] *ot1078 *ot946) otIs908 V. Show Description
otIs908 [pha-4(prom2)::TIR1(F79G)::mTur2::tbb-2 3'UTR + unc-122p::mCherry::unc-54 3' UTR] V. Endogenously-tagged pha-4::GFP::AID crossed with enteric neuron-specific TIR1(F79G), allowing depletion of PHA-4 from pharyngeal nerons, AVL, and RIS by addition of 5-Ph-IAA. Reference: Walker Z, et al. Genes Dev. 2025 Dec 4. doi: 10.1101/gad.353265.125. PMID: 41345038.
|
|
| OH20089 |
C. elegans |
otEx8333. Show Description
otEx8333 [sre-22p::GFP::H2B::tbb-2 3'UTR + unc-122p::GFP]. Maintain by picking GFP+ in coelomocytes. sre-22 promoter fragment drives expression specifically in PVT neuron. Reference: Walker Z, et al. Genes Dev. 2025 Dec 4. doi: 10.1101/gad.353265.125. PMID: 41345038.
|
|
| OH20095 |
C. elegans |
egl-3(nu1711[loxP::egl-3::loxP]) V; otEx8339. Show Description
otEx8339 [sre-22p::2xFlag::NLS::Cre::unc-54 3'UTR + unc-122p::GFP]. Maintain by picking GFP+ in coelomocytes. sre-22 promoter fragment drives expression specifically in PVT neuron, allowing PVT cell-specific Cre-Lox elimination of egl-3 in animals carrying the array. Reference: Walker Z, et al. Genes Dev. 2025 Dec 4. doi: 10.1101/gad.353265.125. PMID: 41345038.
|
|
| OH20099 |
C. elegans |
pha-4(ot1078[loxp::pha-4::GFP::loxp] *ot946) V; otEx8343. Show Description
otEx8343 [sre-22p::2xFlag::NLS::Cre::unc-54 3'UTR + unc-122p::GFP]. Maintain by picking GFP+ in coelomocytes. sre-22 promoter fragment drives expression specifically in PVT neuron, allowing PVT cell-specific Cre-Lox elimination of pha-4 in animals carrying the array. Reference: Walker Z, et al. Genes Dev. 2025 Dec 4. doi: 10.1101/gad.353265.125. PMID: 41345038.
|
|
| OH2024 |
C. elegans |
exc-4(rh133) I; otEx1000. Show Description
otEx1000 [hsp16-2::exc-4(cDNA)::GFP + rol-6(su1006)]. Maintain by picking Rollers.
|
|
| OH3556 |
C. elegans |
che-1(ot124) otIs114 I. Show Description
otIs114 [lim-6p::GFP + rol-6(su1006)]. che-1 mutants result in complete loss of ASE specific cell fate markers. otIs114 reporter, normally expressed in ASEL and excretory gland cells, is lost in ASEL in this mutant.
|
|
| OH3679 |
C. elegans |
che-1(ot151) otIs114 I. Show Description
otIs114 [lim-6p::GFP + rol-6(su1006)]. che-1 mutants result in complete loss of ASE specific cell fate markers. otIs114 reporter, normally expressed in ASEL and excretory gland cells, is lost in ASEL in this mutant.
|
|
| OH3681 |
C. elegans |
otIs114 che-1(ot153) I. Show Description
otIs114 [lim-6p::GFP + rol-6(su1006)]. che-1 mutants result in a complete loss of ASE specific cell fate markers. otIs114, normally expressed in ASEL and excretory gland cells, is lost in ASEL in this mutant.
|
|
| OH4013 |
C. elegans |
otIs114 che-1(ot232) I. Show Description
otIs114 [lim-6p::GFP + rol-6(su1006)]. che-1 mutants result in a complete loss of ASE specific cell fate markers. otIs114, normally expressed in ASEL and excretory gland cells, is lost in ASEL in this mutant.
|
|
| OH707 |
C. elegans |
cog-1(ot38)/+ II; otIs114 I. Show Description
otIs114 [lim-6::GFP + rol-6(su1006)]. Rollers. Heterozygous strain. Heterozygotes should be fertile and segregate some sterile progeny. Maintain by picking plenty of animals with GFP in both ASEL and ASER; many of them will be sterile (homozygotes). otIs114 is normally expressed only in ASEL and excretory gland cell. Homozygous ot38; otIs114 is sterile and expresses GFP in both ASEL and ASER neurons. Heterozygotes display a semi-dominant, partially penetrant "ASEL + ASER" phenotype.
|
|
| OH7511 |
C. elegans |
otIs197. Show Description
otIs197 [unc-14p::hif-1(P621A) + ttx-3p::RFP]. Non-degradable form of HIF-1 expressed from unc-14 promoter in hif-1 mutant background for tissue-specific rescuing experiments.
|
|
| OH7546 |
C. elegans |
vtIs1 V; otIs198. Show Description
vtIs1 [dat-1p::GFP + rol-6(su1006)] V. otIs198 [hsp16-2::ast-1 + ttx-3::DsRed + hsp16-2::NLS::mCherry]. Rollers. Heat shock induces expression of nuclear mCherry and AST-1. Reference: Flames N, Hobert O, 2009 Nature 458, 885-889.
|
|
| OH8585 |
C. elegans |
otIs4; otEx3822. Show Description
otIs4 [gcy-7::GFP]. otEx3822 [ceh-36::CZ-caspase3(p17) + gcy-7::caspase3(p12)-NZ + myo-3::mCherry].
|
|
| OH8593 |
C. elegans |
ntIs1 V; otEx3830. Show Description
ntIs1 [gcy-5p::GFP + lin-15(+)] V. otEx3830 [ceh-36::CZ-caspase3(p17) + gcy-5::caspase3(p12)-NZ + myo-3::mCherry].
|
|
| OH9019 |
C. elegans |
otIs4; otIs253. Show Description
otIs4 [gcy-7::GFP]. otIs253 [ceh-36::CZ-caspase3(p17) + gcy-7::caspase3(p12)-NZ + myo-3::mCherry].
|
|
| OH9022 |
C. elegans |
ntIs1 V; otIs256. Show Description
ntIs1 [gcy-5p::GFP + lin-15(+)] V. otIs256 [ceh-36::CZ-caspase3(p17) + gcy-7::caspase3(p12)-NZ + myo-3::mCherry].
|
|
| OH904 |
C. elegans |
otIs33 IV. Show Description
otIs33 [kal-1::GFP]. Transcriptional kal-1::GFP reporterd expressed in specific subset of neurons, including interneurons (e.g. AIY, AIZ), sensory neurons, motorneurons (e.g. HSN). Expression is also seen in non-neuronal tissues (e.g. spermatheca).
|
|
| OK1083 |
C. elegans |
cuEx828. Show Description
cuEx828 [ceh-19p::snb-1::GFP + rol-6(su1006)]. Pick Rollers to maintain. SNB-1::GFP expression specifically marks synaptic vesicles in the MC pharyngeal neuron. Reference: Kozlova AA, et al. Genetics. 2019 May;212(1):231-243. doi: 10.1534/genetics.119.302053. PMID: 30898771.
|
|
| OK1097 |
C. elegans |
tbx-2(cu32[tbx-2::TY1::GFP::FLAG]) III. Show Description
TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of the endogenous tbx-2 coding sequence by CRISPR/Cas9 genome editing.
|
|
| OK1114 |
C. elegans |
tbx-2(cu37[tbx-2::TY1::GFP::FLAG *bx59]) III. Show Description
TY1::EGFP::3xFLAG tag inserted in frame at stop codon of the endogenous mutant tbx-2(bx59) coding sequence by CRISPR/Cas9 genome editing. Maintain at 15C. Lethal at 25C.
|
|
| ONA18 |
C.elegans |
yokSi3 II; unc-119(ed3) III. Show Description
yokSi3 [spe-11p::trp-3A::TagRFP-T::tbb-2 3'UTR + Cbr-unc-119(+)] II. Reference: Takayama J & Onami S. Cell Rep. 2016 Apr 19;15(3):625-637.
|
|
| ONA20 |
C.elegans |
yokSi3 II; spe-41(sy693) unc-119(ed3) III. Show Description
yokSi3 [spe-11p::trp-3A::TagRFP-T::tbb-2 3'UTR + Cbr-unc-119(+)] II. Reference: Takayama J & Onami S. Cell Rep. 2016 Apr 19;15(3):625-637.
|
|
| ONA37 |
C.elegans |
yokSi10 II; unc-119(ed3) III. Show Description
yokSi10 [trp-3p::GFP::H2B::trp-3 3'UTR + Cbr-unc-119(+)] II. GFP marker can be used for visualization of sperm. Reference: Takayama J & Onami S. Cell Rep. 2016 Apr 19;15(3):625-637.
|
|
| OP50(xu363) |
Escherichia coli |
E. coli [ura-, strR, rnc-, (delta)attB::FRT-lacI-lacUV5p-T7)]. Show Description
Bacteria. RNAi-compatible OP50 strain. Slow growing. When growing this strain, pick single colonies for liquid culture (at least 20 hrs) from a freshly streaked tetracycline LB plate. Do not include tetracycline in liquid culture, as Tet in liquid culture can have long lasting effects on worm lifespan. The authors recommend using standard PEG transformation method to make competent OP50(xu363) cells, but other ways to make competent cells will also likely work for OP50(xu363). Reference: Xiao R, et al. Cell Rep. 2015 May 19;11(7):1123-33.
|
|
| OP521 |
C. elegans |
unc-119(tm4063) III; wgIs521. Show Description
wgIs521 [spr-1::TY1::EGFP::3xFLAG + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov M, et al. Nat Methods (2006) 10:839-44. Zhong, M, et al. PLoS Genet (2010) 6(2):e1000848. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org).
|
|
| OP665 |
C. elegans |
unc-119(tm4063) III; wgIs665. Show Description
wgIs665 [spe-10::TY1::EGFP::3xFLAG + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov M, et al. Nat Methods (2006) 10:839-44. Zhong, M, et al. PLoS Genet (2010) 6(2):e1000848. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org).
|
|
| OP703 |
C. elegans |
unc-119(tm4063) III; wgIs703. Show Description
wgIs703 [spr-3::TY1::EGFP::3xFLAG + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov M, et al. Nat Methods (2006) 10:839-44. Zhong, M, et al. PLoS Genet (2010) 6(2):e1000848. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org).
|
|
| OP707 |
C. elegans |
unc-119(tm4063) III; wgIs707. Show Description
wgIs707 [sptf-1::TY1::EGFP::3xFLAG + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov M, et al. Nat Methods (2006) 10:839-44. Zhong, M, et al. PLoS Genet (2010) 6(2):e1000848. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org).
|
|
| OP769 |
C. elegans |
unc-119(tm4063) III; wgIs769. Show Description
wgIs769 [sptf-2::TY1::EGFP::3xFLAG + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov M, et al. Nat Methods (2006) 10:839-44. Zhong, M, et al. PLoS Genet (2010) 6(2):e1000848. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org).
|
|
| OQ192 |
C. elegans |
gmap-1(ulb13) X. Show Description
CRISPR/Cas9 engineered 1515 bp deletion of gmap-1; flanking sequences ACCTATCCAAAGCTT and TGCCAAGACATTGAA. Dessication sensitive. Shorter body length. Increased permeability of the cuticle. Reference: Ngale Njume F, et al. iScience. 2022 Oct 14;25(11):105357. doi: 10.1016/j.isci.2022.105357. PMID: 36339267.
|
|
| OQ195 |
C. elegans |
gmap-1(ulb13) X; ulbEx112. Show Description
ulbEx112 [gmap-1p::gmap-1(cDNA)::SL2::GFP + unc-122p::RFP]. Pick animals with RFP+ expression in coelomocytes to maintain. ulb13 is a CRISPR/Cas9 engineered 1515 bp deletion of gmap-1; flanking sequences ACCTATCCAAAGCTT and TGCCAAGACATTGAA. Expression of exogenous gmap-1 quantifiable via the GFP signal. Reference: Ngale Njume F, et al. iScience. 2022 Oct 14;25(11):105357. doi: 10.1016/j.isci.2022.105357. PMID: 36339267.
|
|
| OS11484 |
C. elegans |
nsIs700 V Show Description
nsIs700 [nep-2(prom7)::tagRFP]. RFP expression specifically in GLR glia. Reference: Stefanakis N, et al. 2024 Feb 15. doi: 10.1038/s44318-024-00049-w. PMID: 38360995.
|
|
| OS11703 |
C. elegans |
nsIs746 V. Show Description
nsIs746 [nep-2(prom7)::GFP]. GFP expression specifically in GLR glia. Reference: Stefanakis N, et al. 2024 Feb 15. doi: 10.1038/s44318-024-00049-w. PMID: 38360995.
|
|
| OS11715 |
C. elegans |
nsIs758 V. Show Description
nsIs758 [nep-2(prom7)::2xNLS::YFP]. Nuclear YFP expression specifically in GLR glia. Reference: Stefanakis N, et al. 2024 Feb 15. doi: 10.1038/s44318-024-00049-w. PMID: 38360995.
|
|
| OS1579 |
C. elegans |
nsEx858. Show Description
nsEx858 [F16F9.3p::GFP + rol-6(su1006)]. Pick Rollers to maintain. Specific expression of GFP in AMsh. Reference: Bacaj T, et al. Science. 2008 Oct 31;322(5902):744-7.
|
|
| OS1585 |
C. elegans |
nsEx864. Show Description
nsEx864 [F11C7.2p::GFP + rol-6(su1006)]. Pick Rollers to maintain. Specific expression of GFP in AMsh. Reference: Bacaj T, et al. Science. 2008 Oct 31;322(5902):744-7.
|
|
| OS1889 |
C. elegans |
nsEx1066. Show Description
nsEx1066 [F53F4.13p::GFP + rol-6(su1006)]. Pick Rollers to maintain. Specific expression of GFP in AMsh. Reference: Bacaj T, et al. Science. 2008 Oct 31;322(5902):744-7.
|
|
| OS1918 |
C. elegans |
nsEx1086. Show Description
nsEx1086 [T02B11.3p::GFP + rol-6(su1006)]. Pick Rollers to maintain. Specific expression of GFP in AMsh. Reference: Bacaj T, et al. Science. 2008 Oct 31;322(5902):744-7.
|
|
| OS2248 |
C. elegans |
nsIs109. Show Description
nsIs109 [F16F9.3p::DTA(G53E) + unc-122::GFP]. Genetic ablation of AMsh glia by expression of diphtheria toxin under AMsh-specific promoter. unc-122::GFP co-injection marker expressed in coelomocytes. Reference: Bacaj T, et al. Science. 2008 Oct 31;322(5902):744-7
|
|
