Strain Information
| Name | OH18320 View On Wormbase |
|---|---|
| Species | C. elegans |
| Genotype | ins-18(ot1326) daf-16(ot971[daf-16::GFP]) I. |
| Description | ot1326 is CRISPR-engineered 2,029 bp deletion removing the entire ins-18 coding region. Sequence after edit:AGCTCATTTTAATTTAACACAATGGTCCACCGACTACGTGGAAGATCTTCTTGCCTACTG TGCCCCAATT. Reference: Sural S, et al. bioRxiv 2025.01.06.631508; doi: https://doi.org/10.1101/2025.01.06.631508. |
| Mutagen | Crispr/Cas9 |
| Outcrossed | x0 |
| Made by | Surojit Sural |
| Laboratory | OH |
| Reference | Reference: Sural S, et al. bioRxiv 2025.01.06.631508; doi: https://doi.org/10.1101/2025.01.06.631508. |
Sign in
or
register an account if you want to order this strain.