Strain Information

Name OH18320   View On Wormbase
Species C. elegans
Genotypeins-18(ot1326) daf-16(ot971[daf-16::GFP]) I.
Descriptionot1326 is CRISPR-engineered 2,029 bp deletion removing the entire ins-18 coding region. Sequence after edit:AGCTCATTTTAATTTAACACAATGGTCCACCGACTACGTGGAAGATCTTCTTGCCTACTG
TGCCCCAATT.
Reference: Sural S, et al. Sci Adv. 2025 Sep 26;11(39):eadw1270. doi: 10.1126/sciadv.adw1270. PMID: 40991693.
MutagenCrispr/Cas9
Outcrossedx0
Made bySurojit Sural
Laboratory OH
Reference Reference: Sural S, et al. Sci Adv. 2025 Sep 26;11(39):eadw1270. doi: 10.1126/sciadv.adw1270. PMID: 40991693.
Sign in or register an account if you want to order this strain.