Search Strains

More Fields See WormTagDB for other published tagged loci.
Strain Species Genotype Add
OW715 C. elegans tdo-2(zg216) III. Show Description
Crispr/Cas9 engineered deletion mutant removes 28 basepairs in tdo-2 coding region. Reference: Michels H, et al. Sci Rep. 2016 Dec 20;6:39199.
OW716 C elegans tdo-2(zg217) III. Show Description
Crispr/Cas9 engineered deletion mutant removes 14 basepairs in tdo-2 coding region. Reference: Michels H, et al. Sci Rep. 2016 Dec 20;6:39199.
OW717 C elegans tdo-2(zg218) III. Show Description
Crispr/Cas9 engineered deletion mutant removes 9 basepairs in tdo-2 coding region. Reference: Michels H, et al. Sci Rep. 2016 Dec 20;6:39199.
PB206 C. remanei Show Description
Male-female strain. From association with a terrestrial isopod, Trachelipus rathkii, that was collected from the Wright State University Biology Preserve, Dayton Ohio. Species ID confirmed by mating test with EM464.
PB212 C. remanei Show Description
Male-female strain. From association with a terrestrial isopod, Trachelipus rathkii, that was collected from the Wright State University Biology Preserve, Dayton Ohio. Species ID confirmed by mating test with EM464.
PB219 C. remanei Show Description
Male-female strain. From association with a terrestrial isopod, Trachelipus rathkii, that was collected from Cox Arboretum, Dayton Ohio. Species ID confirmed by mating test with EM464.
PB227 C. remanei Show Description
Male-female strain. From association with a terrestrial isopod, Trachelipus rathkii, that was collected from Taylorsville MetroPark, Dayton Ohio. Species ID confirmed by mating test with SB146.
PB228 C. remanei Show Description
Male-female strain. From association with a terrestrial isopod, Armadillidium vulgare, that was collected from Eastwood MetroPark, Dayton Ohio. Species ID confirmed by mating test with SB146.
PB229 C. remanei Show Description
Male-female strain. From association with a terrestrial isopod, Cylisticus convexus, that was collected from Englewood MetroPark, Dayton Ohio. Species ID confirmed by mating test with SB146.
PB303 C. elegans Show Description
Caenorhabditis elegans from association with a terrestrial isopod, Porcellio scaber, that was obtained from Ward's Biological Supply. Species ID confirmed by mating tests with JK574 fog-2(q71). Caenorhabditis elegans wild isolate.
PB306 C. elegans Show Description
Caenorhabditis elegans from association with a terrestrial isopod, Porcellio scaber, that was obtained from Connecticut Valley Biological Supply. Species ID confirmed by mating tests with JK574 fog-2(q71). Caenorhabditis elegans wild isolate.
PB800 C. briggsae Show Description
Caenorhabditis briggsae from soil at the base of mushrooms, 228 Park Drive, Dayton Ohio. Variable ray pattern, many males with pattern similar to that of C. elegans. Species ID confirmed by mating tests with AF16.
PB826 C. briggsae Show Description
Wild type isolate of Caenorhabditis briggsae that was obtained from association with a snail in Hueston Woods State Park in Ohio. Species ID confirmed by mating test with AF16.
PD1594 C. elegans ccTi1594 unc-119(ed3) III. Show Description
ccTi1594 [mex-5p::GFP::gpr-1::smu-1 3'UTR + Cbr-unc-119(+), III: 680195] III. GFP expression in germline. Transgene rescues unc-119(ed3). Improved GPR-1 over-expression transgene appears to be stably expressed in the germline at a wide range of temperatures and does not require special handling. (unlike other GPR-1 overexpressing transgenes previously described in the literature). The GPR-1 overexpression transgene consistently confers a high penetrance of non-Mendelian inheritance. Neomycin resistant. The genomic location of ccTi1594 is with respect to the WEBcel235 assembly.
PD2217 C. elegans ccTi1594 unc-119(ed3) III; hjSi20 IV. Show Description
ccTi1594 [mex-5p::GFP::gpr-1::smu-1 3'UTR + Cbr-unc-119(+), III: 680195] III. hjSi20 [myo-2p::mCherry::unc-54 3'UTR] IV. GFP expression in germline. mCherry expression in pharynx. The ccTi1594 transgene rescues unc-119(ed3). High penetrance of non-Mendelian inheritance. The GPR-1 overexpression transgene consistently confers a high penetrance of non-Mendelian inheritance; fluorescent markers allow tracking of Mendelian and non-Mendelian events. The genomic location of ccTi1594 is with respect to the WEBcel235 assembly.
PD2218 C. elegans ccTi1594 umnIs7 III. Show Description
ccTi1594 [mex-5p::GFP::gpr-1::smu-1 3'UTR + Cbr-unc-119(+), III: 680195] III. umnIs7 [myo-2p::GFP + NeoR, III:9421936] III. GFP expression in germline and GFP expression in pharynx. High penetrance of non-Mendelian inheritance. Neomycin resistant. The GPR-1 overexpression transgene consistently confers a high penetrance of non-Mendelian inheritance; fluorescent markers allow tracking of Mendelian and non-Mendelian events. The genomic location of ccTi1594 is with respect to the WEBcel235 assembly.
PD2220 C. elegans ccTi1594 umnIs27 III. Show Description
ccTi1594 [mex-5p::GFP::gpr-1::smu-1 3'UTR + Cbr-unc-119(+), III: 680195] III. umnIs27 [myo-2::GFP + NeoR, III: 8856215 (intergenic)] III. GFP expression in germline and GFP expression in pharynx. High penetrance of non-Mendelian inheritance. Neomycin resistant. The GPR-1 overexpression transgene consistently confers a high penetrance of non-Mendelian inheritance; fluorescent markers allow tracking of Mendelian and non-Mendelian events. The genomic location of ccTi1594 is with respect to the WEBcel235 assembly.
PD2224 C. elegans oxIs322 II; ccTi1594 umnIs7 III. Show Description
oxIs322 [myo-2p::mCherry::H2B + myo-3p::mCherry::H2B + Cbr-unc-119(+)] II. ccTi1594 [mex-5p::GFP::gpr-1::smu-1 3'UTR + Cbr-unc-119(+), III: 680195] III. umnIs7 [myo-2p::GFP + NeoR, III:9421936] III. mCherry expression in pharyngeal and body wall muscle nuclei. GFP expression in germline and GFP expression in pharynx. High penetrance of non-Mendelian inheritance. Neomycin resistant. The GPR-1 overexpression transgene consistently confers a high penetrance of non-Mendelian inheritance; fluorescent markers allow tracking of Mendelian and non-Mendelian events. The genomic location of ccTi1594 is with respect to the WEBcel235 assembly.
PD2227 C. elegans oxIs322 II; ccTi1594 III. Show Description
oxIs322 [myo-2p::mCherry::H2B + myo-3p::mCherry::H2B + Cbr-unc-119(+)] II. ccTi1594 [mex-5p::GFP::gpr-1::smu-1 3'UTR + Cbr-unc-119(+), III: 680195] III. mCherry expression in pharyngeal and body wall muscle nuclei. GFP expression in germline. High penetrance of non-Mendelian inheritance. The GPR-1 overexpression transgene consistently confers a high penetrance of non-Mendelian inheritance; fluorescent markers allow tracking of Mendelian and non-Mendelian events. The genomic location of ccTi1594 is with respect to the WEBcel235 assembly.
PD2859 C. elegans unc-54(cc2859[unc-54::GFP::TAA::NSUTR]) I. Show Description
Endogenous unc-54::GFP made by CRISPR. Exhibits green thick muscle filaments in the body wall muscle. Weakly Unc. Reference: Arribere JA, Cenik ES, Jain N, Hess GT, Lee CH, Bassik MC, Fire AZ. Translation readthrough mitigation. Nature. 2016 Jun 30;534(7609):719-23. Epub 2016 Jun 1.
PD2882 C. elegans unc-54(cc2882[unc-54[G387R]::gfp::TAA::NSUTR]) I. Show Description
cc2882 is a CRISPR/Cas9-induced G387R mutation of unc-54 in parental strain PD2859, mimicking the molecular lesion e1301. Unc at room temperature. Reference: Arribere JA & Fire AZ. ELife, vol. 7, Aug. 2018, doi:10.7554/elife.33292.
PD4482 C. elegans lmp-1(nr2045). Show Description
Deletion that spans exons 1-3 (out of 4) and is presumed to be a null. Under EM, one type of intestinal granule is missing. Missing type is not acidic, and does not stain with nile red. Under DIC, gut is lighter and the granules are not as densely packed.
PD4655 C. elegans dpy-20(e1282) IV; ccIs4655. Show Description
ccIs4655 [pes-10::GFP + dpy-20(+) ]. GFP expression in lineages with active HLH-8/HLH-2 (e.g., sex muscle, head mesodermal cell). Transgene contains pes-10::GFP reporter driven by 8 copies of an HLH-8/HLH-2 response site from the ceh-24 promoter.
PD7271 C. elegans pha-1(e2123) III; ccEx7271. Show Description
ccEx7271 [let-858::GFP + pha-1(+)]. This strain expresses nuclear-localized GFP in all somatic nuclei, but reduced or no GFP in germ cells. If maintained at 20C, pha-1(ts) genotype will select for transgenic animals. Sporadic germ cell expression can be observed when maintained at 25C.
PE97 C. elegans hmp-1(fe4) V. Show Description
Semi-viable Vab. Homozygotes produce approximately 40% arrested embryos/L1 larvae. Severe morphogenesis defects show maternal rescue: homozygous progeny of heterozygotes display only minor morphological defects.
PG-1 Unknown species Show Description
Not interfertile with N2. Growth slow. Morphogenesis differs from N2. Collected by M.GALLO. PG-1, -2, -3 appear to be the same species. (Carl Johnson 6/26/93).
PG-2 Unknown species Show Description
Not interfertile with N2. Growth slow. Morphogenesis differs from N2. Collected by M.GALLO. PG-1, -2, -3 appear to be the same species. (Carl Johnson 6/26/93).
PG-3 Unknown species Show Description
Not interfertile with N2. Growth slow. Morphogenesis differs from N2. Collected by M.GALLO. PG-1, -2, -3 appear to be the same species. (Carl Johnson 6/26/93).
PHX1048 C. elegans hdl-1(syb1048[hdl-1::gfp]) IV. Show Description
GFP tag inserted at the C-terminus of the endogenous hdl-1 locus by CRISPR/Cas9. Reference: Wang C, et al. Elife. 2024 Oct 18:13:RP95402. doi: 10.7554/eLife.95402. PMID: 39422452.
PHX1965 C. elegans nlp-29(syb1965[nlp-29::linker::mKate2]) V. Show Description
Endogenous locus tagged with mKate2 using CRISPR/Cas9. Enables visualisation of this secreted AMP in the cuticle upon genetic or physical cuticle damage. Reference: Pujol N & Bringmann H. 2025. microPublication Biology. A knock-in translational reporter for NLP-29 reveals AMP secretion to the apical extracellular matrices following epidermal damage in Caenorhabditis elegans. 10.17912/micropub.biology.001435.
PHX209 C. elegans R12G8.1(syb209) V. Show Description
Complete CRISPR/Cas-9 knock-out (1143bp deletion) of the gene R12G8.1. Homozygous. Superficial wild-type. Primers for crossing: Fwd: agctccggggacatcaaata InFwd: CTGAAAACTCGTCGTAGCCG Rev: tcagaggtccgtggttcaaa Wild-type bands: 402bp, 1427bp. Mutation band: 284bp.
PHX2172 C. elegans sin-3(syb2172) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Maternal effect sterile deletion balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP+, arrested hT2 aneuploids, and non-GFP syb2172 homozygotes (maternal effect sterile). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP+ and check for correct segregation of progeny to maintain. syb2172 is CRISPR-engineered deletion removing the ATG start codon and entire sin-3 coding region. Reference: Robert VJ, et al. Development. 2023 Oct 17;150(21):dev201755. doi: 10.1242/dev.201755 PMID: 37818613.
PHX2457 C. elegans dmsr-7(syb2457) V. Show Description
Molecular null allele. syb2457 is a CRISPR-engineered deletion of the entire dmsr-7 coding region. Reference: Rossi L, et al. Curr Biol. 2025 Apr 20:S0960-9822(25)00355-0. doi: 10.1016/j.cub.2025.03.039. PMID: 40273913.
PHX2605 C. elegans ceh-13(syb2605[ceh-13::GFP]) III. Show Description
GFP tag inserted at the C-terminus of the endogenous ceh-13 locus by CRISPR. Reference: Murray JI, et al. PLOS Genet. 2022 May 2;18(5):e1010187. PMID: 35500030
PHX2634 C. elegans flp-3(syb2634[flp-3::T2A::3XNLS::GFP]) X. Show Description
GFP tag inserted at the C-terminus of the endogenous flp-3 locus by CRISPR. Allele generated by SUNY Biotech. Reference: Tekieli T. et al. Development. 2021 Sep 15;148(18):dev199687. doi: 10.1242/dev.199687. PMID: 34415309.
PHX2658 C. elegans flp-1(syb2658[flp-1::T2A::3XNLS::GFP]) IV. Show Description
GFP tag inserted at the C-terminus of the endogenous flp-1 locus by CRISPR. Allele generated by SUNY Biotech. Reference: Taylor SR, et al. Cell. 2021 Aug 5;184(16):4329-4347.e23. doi: 10.1016/j.cell.2021.06.023. PMID: 34237253.
PHX2679 C. elegans nob-1(syb2679[nob-1::GFP]) III. Show Description
GFP tag inserted at the C-terminus of the endogenous nob-1 locus by CRISPR. Reference: Murray JI, et al. PLOS Genet. 2022 May 2;18(5):e1010187. PMID: 35500030
PHX2805 C. elegans nlp-51(syb2805 [nlp-51::T2A::3xNLS::GFP]) II. Show Description
GFP tag inserted at the C-terminus of the endogenous nlp-51 locus by CRISPR. Allele generated by SUNY Biotech. Reference: Taylor SR, et al. Cell. 2021 Aug 5;184(16):4329-4347.e23. doi: 10.1016/j.cell.2021.06.023. PMID: 34237253.
PHX2878 C. elegans ric-4(syb2878[ric-4::T2A::3xNLS::GFP]) V. Show Description
T2A::3xNLS::GFP tag inserted at the C-terminus of the endogenous ric-4 locus by CRISPR. Allele generated by SUNY Biotech. Reference: Leyva-Diaz E & Hobert O. Current Biol. 2022 Mar 3;S0960-9822(22)00262-7. PMID: 35259341
PHX2880 C. elegans ceh-16(syb2709[loxP] syb2880[ceh-16::loxP::GFP]) III. Show Description
GFP tag inserted at the C-terminus of the endogenous ceh-16 locus by CRISPR. Allele generated by SUNY Biotech. Reference: Reilly MB, et al. bioRxiv 2022.04.29.490095; doi: https://doi.org/10.1101/2022.04.29.490095
PHX2934 C. elegans ceh-37(syb2933[loxP]) ceh-36(syb2934[ceh36::loxP::GFP]) X. Show Description
CRISPR/Cas9 engineered tagged endogenous locus. Reference: Reilly MB, et al. Widespread employment of conserved C. elegans homeobox genes in neuronal identity specification. bioRxiv 2022.04.29.490095; doi: https://doi.org/10.1101/2022.04.29.490095
PHX3072 C. elegans rab-3(syb3072[rab-3::T2A::3xNLS::GFP]) II. Show Description
T2A::3xNLS::GFP tag inserted at the C-terminus of the endogenous rab-3 locus by CRISPR. Allele generated by SUNY Biotech. Reference: Leyva-Diaz E & Hobert O. Current Biol. 2022 Mar 3;S0960-9822(22)00262-7. PMID: 35259341
PHX3112 C. elegans nlp-12(syb3112[nlp-12::T2A::3×NLS::GFP]) I. Show Description
Endogenous locus tagged with T2A::3xNLS::GFP using CRISPR/Cas9. Please contact Oliver Hobert prior to publishing work using this strain.
PHX3169 C. elegans flp-12(syb3169[flp-12::T2A::3xNLS::GFP]) X. Show Description
Endogenous locus tagged with T2A::3xNLS::GFP using CRISPR/Cas9. Please contact Oliver Hobert prior to publishing work using this strain.
PHX3172 C. elegans flp-25(syb3172[flp-25::T2A::3×NLS::GFP]) III. Show Description
Endogenous locus tagged with T2A::3xNLS::GFP using CRISPR/Cas9. Please contact Oliver Hobert prior to publishing work using this strain.
PHX3179 C. elegans nlp-10(syb3179[nlp-10::T2A::3×NLS::GFP]) III. Show Description
Endogenous locus tagged with T2A::3xNLS::GFP using CRISPR/Cas9. Please contact Oliver Hobert prior to publishing work using this strain.
PHX3184 C. elegans flp-17(syb3184[flp-17::T2A::3xNLS::GFP]) IV. Show Description
Endogenous locus tagged with T2A::3xNLS::GFP using CRISPR/Cas9. Please contact Oliver Hobert prior to publishing work using this strain.
PHX3186 C. elegans nlp-3 (syb3186 [nlp-3::T2A::3XNLS::GFP]) X. Show Description
GFP tag inserted at the C-terminus of the endogenous nlp-3 locus by CRISPR. Allele generated by SUNY Biotech. Please contact Oliver Hobert prior to publishing work using this strain.
PHX3187 C. elegans flp-10(syb3187[flp-10::T2A::3xNLS::GFP]) IV. Show Description
Endogenous locus tagged with T2A::3xNLS::GFP using CRISPR/Cas9. Please contact Oliver Hobert prior to publishing work using this strain.
PHX3191 C. elegans nlp-58(syb3191 [nlp-58::T2A::3xNLS::GFP]) V. Show Description
GFP tag inserted at the C-terminus of the endogenous nlp-58 locus by CRISPR. Allele generated by SUNY Biotech. Reference: Ripoll-Sanchez L, et al. Neuron. 2023 Nov 15;111(22):3570-3589.e5. doi: 10.1016/j.neuron.2023.09.043. PMID: 37935195.