Search Strains

pkIs591[dpy-20(+) + gap-15::GFP]. GFP expression in ADL, ASH, ASK, PHA, PHB, distal tip cell, anchor cell, and many male-specific neurons.

Heterozygotes are WT and segregate WT, blistered, and lethals. pk481 previously called spn-1.

pkIs1275 [gpc-2::GFP + dpy-20(+)]. Reporter construct includes 2.3 kbp of upstream sequence and most of the gpc-2 open reading frame. 2.5 kbp PCR fragment generated with primers gpc2-1 (TCTGCAGCACGACGATAATC, extended with a SphI site) and gpc2-2 (GTCGATTGGGTTCACAAGTG, extended with a BamHI site) into vector pPD95.77. Reference: Jansen G, et al. EMBO J. 2002 Mar 1;21(5):986-94.

Mutator phenotype. Enhanced level of spontaneous mutations (frameshifts and single base pair substitutions). The genomic region that is deleted in NL2511 is from nt 24180-25956 (takes out exon 5 and part of exon 6).

Reduced response to exogenously added dauer pheromone and thus defective in the regulation of dauer formation.

Reduced response to exogenously added dauer pheromone and thus defective in the regulation of dauer formation.

Reduced response to exogenously added dauer pheromone and thus defective in the regulation of dauer formation.

CRISPR-engineered deletion removing entire cdc-7 gene. Out-crossed 3x to N2. Reference: Currey HN & Liachko NF. 2019. A CRISPR/Cas9-generated cdc-7 loss of function mutation does not cause temperature-dependent fertility defects. microPublication Biology. Jan 3;2019:10.17912.

Aldicarb resistant. Lethargic Unc - jerky especially in backward movement. Low pumping rate. Molecular lesion for md247 is a 20 bp duplication yielding a frameshift mid-way through the transmembrane domain.

jsSi1815 [loxP::mex-5p::FLP::sl2::mNeonGreen + rpl-28p::FRT::GFP::his-58 3' FRT3] V. Single component RMCE landing site on Chromosome V adjacent to oxTi365. Created using CRISPR/cas9 with SEC selection and heat shock excision. Unpublished as of 5-2-2022. See https://sites.wustl.edu/nonetlab/rrmce-landing-sites/ for sequence of insertion.

arIs37 [myo-3p::ssGFP + dpy-20(+)] I. cdIs32 [unc-122p::DT-A(E148D) + myo-2p::GFP + unc-119(+)]. A diphtheria toxin A fragment DT-A (E148D) is expressed under a coelomocyte-specific promoter leading to the absence of coelomocytes. Worms are slightly uncoordinated, slightly dumpy and slow growing. References: Fares H & Greenwald I. Genetics. 2001 Sep;159(1):133-45. doi: 10.1093/genetics/159.1.133. PMID: 11560892. Schwartz MS, et al. PLoS One. 2010 Mar 5;5(3):e9564. doi: 10.1371/journal.pone.0009564. PMID: 20221439.

kzIs9 [(pKK1260) lin-26p::NLS::GFP + (pKK1253) lin-26p::rde-1 + rol-6(su1006)]. Rollers. Hypodermis specific RNAi.

kzIs20 [hlh-1p::rde-1 + sur-5p::NLS::GFP]. Muscle specific RNAi. kzIs20 genotype differs from published data; this information is correct per Hiroshi Qadota.

Previously called cet-1(kk3). Short, somewhat Dpy. Males have crumpled spicules and abnormal rays; Similar to sma-2, sma-3, sma-4, sma-6 and daf-4.

Reduced fertility. Reduced long-term survival. Mutator phenotype. DNA damage-induced apoptosis in the germ line. No effect on lifespan or meiotic chromosome disjunction observed.

Heterozygotes display abnormal distal tip cell migration detectable as clear patches in anterior and posterior. Heterozygotes segregate WT, Dpy, abnormal DTC migration, Unc, and dead eggs. Maintain by picking wild-type.

Heterozygotes display partially penetrant (~10%) abnormal distal tip cell migration detectable as clear patches in anterior and posterior. Heterozygotes segregate WT, abnormal DTC migration, Unc, and dead eggs. Maintain by picking wild-type.

jcIs1 [ajm-1::GFP + unc-29(+) + rol-6(su1006)] IV. Strain does not Roll but otherwise seems fine. Male ray 1 anterior displacement in homozygous animals. Genetic interaction with smp-2(ev709). Vulva cell migration defects. ajm-1 was formerly known as jam-1 (Junction Associated Protein) and "the gene encoding the antigen recognized by the monoclonal antibody MH27." jcIs1 consists of pJS191, C45D3 and pRF4. Reference: Koppen M, et al. Nat Cell Biol. 2001 Nov;3(11):983-91.

jcIs1 [ajm-1::GFP + unc-29(+) + rol-6(su1006)] IV. Strain does not Roll but otherwise seems fine. Male ray 1 anterior displacement in homozygous animals. Genetic interaction with smp-1(ev715). ajm-1 was formerly known as jam-1 (Junction Associated Protein) and "the gene encoding the antigen recognized by the monoclonal antibody MH27." jcIs1 consists of pJS191, C45D3 and pRF4. Reference: Koppen M, et al. Nat Cell Biol. 2001 Nov;3(11):983-91.

Unc. Kinker, especially in backward movement.

Unc. Kinker, especially in backward movement.

Unc. Kinker, especially in backward movement.

GFP tag inserted into endgonenous par-2 locus in an analogue-sensitive background. pkc-3(crk77[I331A,T394A]) is a CRISPR-engineered analog-sensitive allele containing both I331A (gatekeeper site) and T394A (suppressor site) mutations, allowing rapid and reversible chemical inhibition of PKC-3 activity. Reference: Ng K, et al. (2022). An analog sensitive allele permits rapid and reversible chemical inhibition of PKC-3 activity in C. elegans. Reference: Ng K, et al. microPublication Biology. 10.17912/micropub.biology.000610

bsIs2 [pie-1::GFP::spd-2 + unc-119(+)]. ruIs32 [pie-1p::GFP::H2B + unc-119(+)] III. Wild type animals express GFP marked DNA (GFP-H2b) and centrosomes (GFP-SPD-2) in germ line and embyros. Maintain at 24C to obtain optimal GFP expression.

ocfIs2 [pie-1p:mCherry::sp12::pie-1 3'UTR + unc-119(+)]. Stable germline and embryonic expression of ER and NE marker, useful for following NE dynamics through early development. Reference: Joseph-Strauss D, et al. Dev Biol. 2012 May 15;365(2):445-57.

ltIs78 [(pKO5) pie-1::GFP::TEV::Stag::air-1 spliced coding + unc-119(+)].

CRISPR/Cas9 engineered deletion of mdf-2 in which the mdf-2 coding sequence was replaced by unc-119. Heterozygotes are wild-type GFP+ and segregate mdf-2 null homozygotes (low brood size/embryonic lethal), wild-type GFP+ heterozygotes, and arrested nT1[qIs51] aneuploids. Pick wild-type GFP+ and check for correct segregation of progeny to maintain. Unknown if unc-119(ed3) from parental strain is still carried in the background. gRNA sequence: Gccaaattccccagttttag Reference: Lara-Gonzalez P, et al. Dev Cell. 2019 Nov 4;51(3):313-325.e10. doi: 10.1016/j.devcel.2019.09.005. PMID: 31588029.

ltSi569 [CEOP3608 tbg-1::mCherry + Cbr-unc-119(+)] inserted into oxTi185 [ttTi5605 + NeoR(+) + unc-18(+)] I. ltSi592 [spd-2p::gfp::spd-5(S653A S658A, re-encoded) + Cbr-unc-119(+)] II. Small centrosomes. mCherry-labeled gamma tubulin. GFP-labeled centrioles. Derived by crossing parental strains OD1801 with OD1709. Reference: Woodruff JB, et al. Science. 2015 May 15;348(6236):808-12. doi: 10.1126/science.aaa3923. PMID: 25977552

CRISPR/Cas9 engineered deletion of fzy-1 in which the fzy-1 coding sequence was replaced by LoxP. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are wild-type with relatively dim pharyngeal GFP signal, and segregate wild-type dim GFP (heterozygotes), Dpy bright GFP (mIn1 homozygotes), and non-GFP fzy-1 homozygotes (larval arrest). Pick wild-type with dim GFP and check for correct segregation of progeny to maintain. gRNA sequence: Ggacgcacgcccggtagtgc Reference: Kim T, et al. Genes Dev. 2017 Jun 1;31(11):1089-1094. doi: 10.1101/gad.302067.117. PMID: 28698300.

ltSi569 [CEOP3608 tbg-1::mCherry + Cbr-unc-119(+)] inserted into oxTi185 [ttTi5605 + NeoR(+) + unc-18(+)] I. ltSi1141 [spd-2p::gfp::spd-5(re-encoded) + Cbr-unc-119(+)] II. Re-encoded spd-5 is siRNA-resistant. mCherry-labeled gamma tubulin. GFP-labeled centrioles. Reference: Woodruff JB, et al. Science. 2015 May 15;348(6236):808-12. doi: 10.1126/science.aaa3923. PMID: 25977552

ltSi794 [dpy-7p::vhhGFP4::zif-1::unc-54 3'UTR + Cbr-unc-119(+)] II. Hypodermal-specific anti-GFP nanobody fused to ZIF-1 (Mediated by recruited ZIF-1 but NOT requiring ZF1 tags) mediates hypodermis-specific degradation of GFP-tagged proteins. Can be combined with endogenous locus GFP-tagging or rescue of a null mutant with a GFP fusion to examine hypodermis-specific functions of target genes. Reference: Wang S, et al. Elife. 2015 Sep 15;4:e08649. Wang S, et al. http://biorxiv.org/content/early/2017/01/30/104398

ltSi910 [elt-2p::vhhGFP4::zif-1::operon-linker::mCherry::his-11::tbb-2 3'UTR + Cbr-unc-119(+)] II. Intestinal-specific expression of anti-GFP nanobody fused to ZIF-1 mediates intestine-specific degradation of GFP-tagged proteins (mediated by recruited ZIF-1 but NOT requiring ZF1 tags). Can be combined with endogenous locus GFP-tagging or rescue of a null mutant with a GFP fusion to examine intestine-specific functions of target genes. Reference: Wang S, et al. Development. 2017 Jun 15. pii: dev.150094. doi: 10.1242/dev.150094.

ltSi912 [myo-3p::vhhGFP4::zif-1::operon-linker::mCherry::his-11::tbb-2 3'UTR + Cbr-unc-119(+)] II. Muscle-specific expression of anti-GFP nanobody fused to ZIF-1 mediates body wall muscle-specific degradation of GFP-tagged proteins (through recruited ZIF-1 but NOT requiring ZF1 tags). Can be combined with endogenous locus GFP-tagging or rescue of a null mutant with a GFP fusion to examine body wall muscle-specific functions of target genes. Reference: Wang S, et al. Development. 2017 Jun 15. pii: dev.150094. doi: 10.1242/dev.150094.

ltSi914 [osm-6p::vhhGFP4::zif-1::operon-linker::mCherry::his-11::tbb-2 3'UTR + Cbr-unc-119(+)] II. Sensory neuron-specific expression of anti-GFP nanobody fused to ZIF-1 mediates sensory neuron-specific degradation of GFP-tagged proteins (through recruited ZIF-1 but NOT requiring ZF1 tags). Can be combined with endogenous locus GFP-tagging or rescue of a null mutant with a GFP fusion to examine sensory neuron-specific functions of target genes. Reference: Wang S, et al.  Development. 2017 Jun 15. pii: dev.150094. doi: 10.1242/dev.150094.

ltSi915 [osm-6p::zif-1::operon-linker::mCherry::histone::tbb-2 3'UTR + Cbr-unc-119(+)] II. This strain provides a sensory neuron-specific source of ZIF-1 alone and serves as a control strain for OD2772, which mediates ciliated sensory neuron-specific degradation of GFP-tagged proteins. It can also be used as source of sensory-specific ZIF-1 for other applications. Superficially wild type. Reference: Wang S, et al. Development. 2017 Jun 15. pii: dev.150094. doi: 10.1242/dev.150094.

mNeonGreen and Flag tags inserted at 5' end of endogenous mdf-1 locus using CRISPR/Cas9 engineering. gRNA sequence: tgattgcattaaacatatt Reference: Kim T, et al. Genes Dev. 2017 Jun 1;31(11):1089-1094. doi: 10.1101/gad.302067.117. PMID: 28698300.

GFP tag inserted at 5' end of endogenous san-1 locus using CRISPR/Cas9 engineering. gRNA sequence: taaaataatatgtataaac

ltSi953 [mec-18p::vhhGFP4::zif-1::operon-linker::mKate::tbb-2 3'UTR + Cbr-unc-119(+)] II. Touch response neuron (TRN)-specific expression of anti-GFP nanobody fused to ZIF-1 mediates TRN-specific degradation of GFP-tagged proteins (through recruited ZIF-1 but NOT requiring ZF1 tags). Can be combined with endogenous locus GFP-tagging or rescue of a null mutant with a GFP fusion to examine TRN neuron-specific functions of target genes. Reference: Wang S, et al. http://biorxiv.org/content/early/2017/01/30/104398

ltSi1 [knl-1p::knl-1(re-encoded)::RFP + Cbr-unc-119(+)] II. KNL-1::RFP has been re-coded to be knl-1(RNAi) resistant. Reference: Espeut J, et al. Cell Rep. 2015 Jul 7;12(1):58-65. doi: 10.1016/j.celrep.2015.05.039. PMID: 26119738

mCherry tag inserted at N-terminus of endogenous knl-1 locus using by CRISPR/Cas9 engineering. Reference: Cheerambathur DK, et al. Dev Cell. 2019 Mar 25;48(6):864-872.e7. doi: 10.1016/j.devcel.2019.02.002. PMID: 30827898

Analog-sensitive allele generated by CRISPR/Cas9 engineering of the endogenous plk-1 locus. Engineered mutations confer sensitivity to 1-NM-PP1 for drug inhibition of plk-1. gRNA sequences: GGACGATTTTTGGGCAAGGG & TCTCAACGTGTATATCACTT Reference: Gomez-Cavazos JS, et al. Curr Biol. 2020 Aug 17;30(16):3101-3115.e11. doi: 10.1016/j.cub.2020.05.090 PMID: 32619481.

CRISPR/Cas9 engineered deletion of cyb-3. Heterozygotes are wild-type GFP+ and segregate mdf-2 null homozygotes (embryonic lethal), wild-type GFP+ heterozygotes, and arrested nT1[qIs51] aneuploids. Pick wild-type GFP+ and check for correct segregation of progeny to maintain. gRNA sequences: tcaggtcgacattcttggcc & gttatgggtatgagagcatt Reference: Lara-Gonzalez P, et al. Dev Cell. 2019 Nov 4;51(3):313-325.e10. doi: 10.1016/j.devcel.2019.09.005. PMID: 31588029.

mNeonGreen and Flag tags inserted at 3' end of endogenous cyb-1 locus using CRISPR/Cas9 engineering. gRNA sequence: atgcgtccacttttgcattc Reference: Lara-Gonzalez P, et al. Dev Cell. 2019 Nov 4;51(3):313-325.e10. doi: 10.1016/j.devcel.2019.09.005. PMID: 31588029.

mNeonGreen and Flag tags inserted at 5' end of endogenous cyb-3 locus using CRISPR/Cas9 engineering. Strain has lethality and brood size defects. gRNA sequence: tgaagtcaggtcgacattct Reference: Lara-Gonzalez P, et al. Dev Cell. 2019 Nov 4;51(3):313-325.e10. doi: 10.1016/j.devcel.2019.09.005. PMID: 31588029.

ltSi220 [mex-5p::GFP::tbb-2::operon-linker::mCherry::his-11 + Cbr-unc-119(+)] I. ltSi1129 [spd-2p::spd-5(re-encoded) + Cbr-unc-119(+)] II. Re-encoded spd-5 is siRNA-resistant. mCherry-labeled histones. GFP-labeled microtubules. Reference: Ohta M, et al. J Cell Biol. 2021 Feb 1;220(2):e202009083. doi: 10.1083/jcb.202009083. PMID: 33399854.

ltSi220 [mex-5p::GFP::tbb-2::operon-linker::mCherry::his-11 + Cbr-unc-119(+)] I. ltSi1219 [spd-2p::spd-5(S653A S658A)::spd-5 3'UTR + Cbr-unc-119(+)] II. Small centrosomes. mCherry-labeled histones. GFP-labeled microtubules. Reference: Ohta M, et al. J Cell Biol. 2021 Feb 1;220(2):e202009083. doi: 10.1083/jcb.202009083. PMID: 33399854.

CRISPR/Cas9 engineered. Tagged MDF-1 at its endogenous locus with mScarlet. gRNA sequence: tgattgcattaaacatatt Reference: Lara-Gonzalez P, et al. Science. 2021 Jan 1;371(6524):64-67. doi: 10.1126/science.abc1424. PMID: 33384372.

ltSi220 [mex-5p::GFP::tbb-2::operon-linker::mCherry::his-11 + Cbr-unc-119(+)] I. ltSi1232 [spd-2p::spd-5(S170A T178A T198A)::spd-5 3'UTR + Cbr-unc-119(+)] II. mCherry-labeled histones. GFP-labeled microtubules. Reference: Ohta M, et al. J Cell Biol. 2021 Feb 1;220(2):e202009083. doi: 10.1083/jcb.202009083. PMID: 33399854.

ltSi569 [CEOP3608 tbg-1::mCherry + Cbr-unc-119(+)] inserted into oxTi185 [ttTi5605 + NeoR(+) + unc-18(+)] I. ltSi1539 [spd-2p::GFP::spd-5 S170A T178A T198A::spd-5 3'UTR + Cbr-unc-119(+)] II. mCherry-labeled microtubules. GFP-labeled centrosomes. Reference: Ohta M, et al. J Cell Biol. 2021 Feb 1;220(2):e202009083. doi: 10.1083/jcb.202009083. PMID: 33399854.

ltSi220 [mex-5p::GFP::tbb-2::operon-linker::mCherry::his-11 + Cbr-unc-119(+)] I. ltSi1561 [spd-2p::spd-5(S170A T178A T198A S653A S658A)::spd-5 3'UTR + Cbr-unc-119(+)] II. mCherry-labeled histones. GFP-labeled microtubules. Reference: Ohta M, et al. J Cell Biol. 2021 Feb 1;220(2):e202009083. doi: 10.1083/jcb.202009083. PMID: 33399854.