| HBR2317 |
C. elegans |
nlp-8(syb762) IV. Show Description
syb762 is a 1076 bp deletion in nlp-8. Flanking sequences: taaaacccggaacc - acttcttgaacaactg Forward primer: TAAAAGCGGAGTAGCGTCCA Reverse primer: CAGATGGTCGGGTGATTTGA syb762 was generated in a mutant background and out-crossed to N2 to remove those background mutations. Reference: Sinner MP, et al. Curr Biol. 2021 Feb 8;31(3):564-577.e12. PMID: 33259791
|
|
| HG231 |
C. elegans |
age-2(yw23) I. Show Description
HG231 exhibits an approximately 20% increase in mean, median and maxium lifespans compared to N2. HG231 exhibits somewhat reduced fertility and somewhat longer development time than N2. It has a normal appearance, movements and mating behavior. It's swimming rate in liquid is slightly higher than N2. STS mapping indicates the most likely location for age-2 is on LG I.
|
|
| HG284 |
C. elegans |
age-2(yw23) I; age-1(hx546) II. Show Description
This double mutant exhibits a doubling of both mean and maximum lifespans at 25C compared to N2. It exhibits a longer lifespan at 25C than it does at 20C. It has somewhat reduced fertility. It has normal development time, appearance, movements and feeding behavior. It's swimming rate in liquid is slightly higher than N2. STS mapping indicates the most likely location for age-2 is on LG I.
|
|
| HY123 |
C. elegans |
nhr-31(ye123) IV. Show Description
Maintain at 15C. Temperature-sensitive: slow growth rate, reduced brood size. Resistant to Cry proteins. Isolated from EMS screen in N2 background. Reference: Kim YM, et al. PLoS Pathog. 2024 Oct 18;20(10):e1012611. doi: 10.1371/journal.ppat.1012611. PMID: 39423230.
|
|
| IG1241 |
C. elegans |
sta-2(ok1860) V. Show Description
Strain derived by outcrossing RB1547 two times to N2 to remove the lethal background mutation in RB1547. Reference: Dierking K, et al. Cell Host Microbe. 2011 May 19;9(5):425-35.
|
|
| JAR16 |
C. elegans |
rps-6(rns6[rps-6::mCherry]) I. Show Description
mCherry tag inserted at 3' end of endogenous rps-6 locus. Reduced thermotolence at 35C compared to N2 controls. Reference: Somers H, et al. Cell Reports Methods. (2022) Apr 25;2(4):100203 PMID: 35497499
|
|
| JCB418 |
C. elegans |
Y67H2A.2(bet63) IV. Show Description
Homozygous viable. Deletion of 2572 bp in parental strain N2. Left flanking sequence: atctatttttttaaggccgaac; Right flanking sequence: tattggcagcaagcgttgcgaa. sgRNA #1: ccatacgttgttgtggagtt; sgRNA #2: tgtgaagcggaaaaccctat.
|
|
| JCB419 |
C. elegans |
Y76A2B.4(bet65) III. Show Description
Homozygous viable. Deletion of 1579 bp in parental strain N2. Left flanking sequence: gcaaaaaaaaacataccaga; Right flanking sequence: cgtggtttcaggccattacg. sgRNA #1: cctcactgatgatcgtcatc; sgRNA #2: aaaggttcagcattcacacg.
|
|
| JCB426 |
C. elegans |
chil-11(bet66) IV. Show Description
Homozygous viable. Deletion of 2532 bp in parental strain N2. Left flanking sequence: agtcaattcggaactccatgt; Right flanking sequence: tctacggtttaaacaactcctc. sgRNA #1: aacgggatctgttcatcaca; sgRNA #2: agtgtgaaacgcaacgtcta.
|
|
| JCB434 |
C. elegans |
K04C2.8(bet68) III. Show Description
Homozygous viable. Deletion of 796 bp in parental strain N2, with insertion of 13 nucleotides(tcaacaaaatgcc) at break. Left flanking sequence: taatatcctccggaccgata; Right flanking sequence: gtcctgactgataatcatcaac. sgRNA #1: tgtgtagtataaacgattat; sgRNA #2: cgggtcacgagtagagatgg.
|
|
| JCB435 |
C. elegans |
C14B1.9(bet70) III. Show Description
Homozygous viable. Deletion of 973 bp in parental strain N2. Left flanking sequence: aaactacggtaacacccatt; Right flanking sequence: tgacggatgcaatgacaaga. sgRNA #1: gagacctacacatgccaaat; sgRNA #2: tttggattaatgttacctga.
|
|
| JCB455 |
C. elegans |
K02D10.3(bet75) III. Show Description
Homozygous viable. Deletion of 247 bp in parental strain N2.Deletion appears to have occurred at the sgRNA #2 cut site. Left flanking sequence: tttataggaatttcaggaat; Right flanking sequence: ttccgtcaccttccgtcaaa. sgRNA #1: aaatgataagaagccaaagc; sgRNA #2: tttgtgtttatgacgagctc.
|
|
| JCB456 |
C. elegans |
algn-12(bet74) V/nT1[qls51] (IV;V). Show Description
Homozygous sterile. Balanced by nT1[qIs51]. Deletion of 3471 bp in parental strain N2. Left flanking sequence: tgatcactcacagttccctgg; Right flanking sequence: gaatggatatgatgatgtatat. sgRNA #1: atgttcgtggaacgacacca; sgRNA #2: aggataaactctctcttgaa.
|
|
| JCB458 |
C. elegans |
T19C4.5(bet77) V. Show Description
Homozygous viable. Deletion of 1581 bp in parental strain N2. Also contains a SNP (A->T) in right flanking sequence (uppercase text). Left flanking sequence: ctactcatgatataccttct; Right flanking sequence: ccggTgctctcttgttgtct. sgRNA #1: gttttcacatgggcaagaga; sgRNA #2: atttcaattccatttcccac.
|
|
| JCB459 |
C. elegans |
C18E9.4(bet80) II. Show Description
Homozygous viable. Deletion of 492 bp in parental strain N2. Left flanking sequence: agccgtttaagatcccaaac; Right flanking sequence: ggatggtcatcattagaatt. sgRNA #1: ttgctgtagattgagtagtt; sgRNA #2: cacggaaccacctcatggga.
|
|
| JCB461 |
C. elegans |
Y116F11B.14(bet83) V. Show Description
Homozygous viable. Deletion of 1493 bp in parental strain N2. Left flanking sequence: attaatttttgaatttcctaca; Right flanking sequence: tgacgggctaatattgaatta. sgRNA #1: attacactataataatgtgt; sgRNA #2: aaacgacaaactcattatga.
|
|
| JCB487 |
C. elegans |
K02D10.1(bet88) III. Show Description
Homozygous viable. Deletion of 2796 bp in parental strain N2. Left flanking sequence: tatgaactttaagaccaact; Right flanking sequence: ggatgggatgcaactgttgc. sgRNA #1: actcatactataagttcagt; sgRNA #2: ctacttgggcaaagccagga.
|
|
| JEL1000 |
C. elegans |
hsr-9(xoe17) I. Show Description
Superfically wild-type. hsr-9(xoe17) was generated by incorporating a stop-in cassette early in the coding region using the co-CRISPR method (Paix et al. 2015). The hsr-9 repair template (gattttgcctcttaaataaaatttcagCAAAAAACCGAGGGGAGACTTGCAATAGGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAGCTAGCTCTCGGATCATCTTGCAAACATGCTTATTGCTGgtaggtattgcaacc) and guide RNA (AGGGGAGACTTGCAATATCT) were injected into N2 and the resulting progeny were analyzed by PCR using TGAAATTAAGGTGGTCACTCGAAG and GTTGTTGTGGGGAGGCTGAA. Reference: Hariri S, et al. (2023). 53bp1 mutation enhances brca1 and bard1 embryonic lethality in C. elegans. microPublication Biology. 10.17912/micropub.biology.000934. PMID: 37581122.
|
|
| JEL1134 |
C. elegans |
polq-1(xoe51) III. Show Description
Superfically wild-type. polq-1(xoe51) was generated by incorporating a stop-in cassette early in the coding region using the co-CRISPR method (Paix et al. 2015). The polq-1 repair template (AGAGAATTCTCTGAAGATCCATTAATATTGCTTACCGAAGGGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAGCTAGCAGAGTTTTCGCCGCAATTCTCAGACTTTGGTAATGATTTC) and guide RNA (ATTGCGGCGAAAACTCTCTT) were injected into N2 and the resulting progeny were analyzed by PCR using ATAGGCAAATGGCTGGACGG and TCAAAGCAGTCTTCTCGGCA. Reference: Hariri S, et al. (2023). 53bp1 mutation enhances brca1 and bard1 embryonic lethality in C. elegans. microPublication Biology. 10.17912/micropub.biology.000934. PMID: 37581122.
|
|
| JEL1162 |
C. elegans |
brd-1(xoe18) III. Show Description
Weak Emb and Him. N2 parental background. Reference: Li Q, et al. PLoS Genet. 2023 Jan 30;19(1):e1010457. doi: 10.1371/journal.pgen.1010457. PMID: 36716349.
|
|
| JH1327 |
C. elegans |
axEx73. Show Description
axEx73 [pie-1p::pie-1::GFP + rol-6(su1006) + N2 genomic DNA]. pie-1::GFP is expressed in embryos and oocytes. This array may have integrated spontaneously since the strain segregates 100% Rollers.
|
|
| JH1448 |
C. elegans |
axEx1125. Show Description
axEx1125 [pie-1p::mex-5::GFP::pie-1 3’UTR + rol-6(su1006) + N2 genomic DNA]. Maintain at 25C. Pick Rollers to maintain. axEx1125 contains pKR2.04, a construct carrying MEX-5::GFP in vector pKR1.42; pKR1.42 uses the pie-1 promoter, enhancer, and 3′ UTR to drive maternal expression of GFP in embryos. Animals with the array are Rollers. Animals which have lost the array are WT.
|
|
| JH1473 |
C. elegans |
itIs153; ojIs1. Show Description
itIs153 [pie-1p::par-2::GFP + rol-6(su1006) + N2 genomic DNA]. ojIs1 [pie-1p::GFP::tbb-2 + unc-119(+)]. Maintain at 25C. Constructed by crossing heterozygous ojIs1 males into KK866 (itIs153) hermaphrodites and selecting for double homozygosity of the arrays. itIs153 is an integrated derivitive of axEx1094.
|
|
| JK5810 |
C. elegans |
fbf-2(q945[3xFLAG::fbf-2]) II. Show Description
3xFLAG tag inserted at N-terminus of endogenous fbf-2 locus. Generated in N2 background. Reference: Ferdous AS, et al. 2023 May 1;150(9):dev201705. doi: 10.1242/dev.201705. PMID: 37070766.
|
|
| JK5942 |
C. elegans |
fog-3(q873[fog-3::3xFLAG]) I; qSi375 II. Show Description
q873[fog-3(1-262)::GGS::3xFLAG::fog-3(263 Phe)] I. qSi375 [mex-5p::eGFP::linker::his-58::3xboxb::tbb-2 3’UTR] II.
The tethering assay allows this strain to be used for determining FOG-3 levels in different genetic backgrounds. Similar fertility to N2 wild type. Reference: Aoki S, et al. Cell Rep. 2018 Jun.26; 23(13):3769-3775
|
|
| JK6526 |
C. elegans |
let-711(q1238[let-711::3xV5]) III. Show Description
GSS linker and 3xV5 tag inserted at C-teminus of endogenous let-711 locus. Generated in N2 background. Reference: Carrick BH, et al. Dev Cell. 2024 Mar 11;59(5):661-675.e7. doi: 10.1016/j.devcel.2024.01.005. PMID: 38290520.
|
|
| JK6563 |
C. elegans |
daz-1(q1254[1xV5::daz-1]) II. Show Description
1xV5 tag inserted at N-teminus of endogenous daz-1 locus. Generated in N2 background. Reference: Carrick BH, et al. Dev Cell. 2024 Mar 11;59(5):661-675.e7. doi: 10.1016/j.devcel.2024.01.005. PMID: 38290520.
|
|
| JK6594 |
C. elegans |
ife-3(q1259[1xV5::ife-3]) V. Show Description
1xV5 tag inserted at N-teminus of endogenous ife-3 locus. Generated in N2 background. Reference: Carrick BH, et al. Dev Cell. 2024 Mar 11;59(5):661-675.e7. doi: 10.1016/j.devcel.2024.01.005. PMID: 38290520.
|
|
| JM149 |
C. elegans |
caIs71. Show Description
caIs71[elt-2p::GFP::HIS-2B::unc-54 3'UTR + rol-6(su1006)]. Rollers. Expresses nuclear-localized GFP in all intestinal nuclei under control of 5.2 kb elt-2 promoter. GFP is fused to Histone H2B + (fused pie-1 and truncated unc-54 3'-UTR). Transgene was integrated into N2 background by exposure to gamma rays. Reference: Dineen A, et al. Dev Biol. 2018 Mar 15;435(2):150-161. PMID: 29360433
|
|
| JMC164 |
C. elegans |
csr-1(tor67[csr-1 exon2::GFP::FLAG IV:7958598]csr- 1(mg660[G120*]) IV) IV . Show Description
Null allele of csr-1 with GFP and 3xFLAG tags inserted into second exon of endgonenous csr-1 locus. tor67 would normally tag both long and short isoforms, but the mg660 allele introduces a stop codon into the first exon so the long isoform is not made and only tagged CSR-1B isoform is produced.
|
|
| JMC245 |
C. elegans |
alg-4(tm1184) III; csr-1(tor67[csr-1 exon2::gfp::3xflag (IV:7958598)], csr-1(mg660[G120*])) alg-3(tm1155) IV; wago-10(tor133) V. Show Description
Quadruple mutant of four spermatogenesis-specific ago genes. Reference: Charlesworth AG, et al. Nucleic Acids Res. 2021 Sep 7;49(15):8836-8865. PMID: 34329465
|
|
| JU1615 |
C. elegans |
C. elegans wild isolate. Show Description
Isolated by Matthew Crook from compost heap, 13 Cherry St., Macleod, Melbourne, Australia, March 2009. *** NOTE: JU1615 is probably a N2 contaminant and not a real wild isolate. This is inferred from genotyping data from Erik Andersen et al. in the Kruglyak lab. (M-A Felix, Dec 2010). For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).
|
|
| KAB34 |
C. elegans |
louIs2. Show Description
louIs2 [ges-1p::mCherry::GFP::SKL::unc-54 3' UTR]. Expresses a mCherry::GFP::serine-lysine-leucine peroxisome signal sequence (SKL) fluorescent pexophagy reporter in the C. elegans intestine. Generated in N2 background. Reference: Dolese DA, et al. Autophagy. 2022 Jul;18(7):1522-1533. https://doi.org/10.1080/15548627.2021.1990647 PMID: 34689720
|
|
| KAE112 |
C. elegans |
seaIs201. Show Description
seaIs201 [myo-3p::human tau (0N4R;V337M)::unc-54 3'UTR + vha-6p::mCherry::unc-54 3'UTR]. Reduced crawling speed, reduced brood size, shortened lifespan, slow development, early paralysis. Human tau transgene is expressed in body wall muscles, producing strong phenotypes suitable for screening and is sensitive to knockdown by feeding RNAi. Generated in N2 background.
|
|
| KDK53250 |
C. elegans |
oskEx53250. Show Description
oskEx53250 [dat-1p::GCaMP6f + dat-1p::mCherry + lin-44p::mRFP + N2 genomic DNA cut with Pvu II (as a carrier)]. Pick animals with red fluorescence to maintain. GCaMP6f and mCherry expressed in dopaminergic neurons. Generated in N2 background. Reference: Tanimoto Y, et al. Sci Rep. 2016 May 19;6:26297. doi: 10.1038/srep26297. PMID: 27193056.
|
|
| KDK94 |
C. elegans |
otIs672; otIs696. Show Description
otIs672 [rab-3p::NLS:: GCaMP6s + arrd-4p::NLS::GCaMP6s]. See description of strain OH16230 for full description of otIs696 NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene used to resolve unique neural identities in whole-brain images. 2-nonanone avoidance and electrical shock response of KDK94 are more similar to wild-type (N2) than other NeuroPAL strains. Derived by crossing parental strains OH15265 and OH15495. References: Endo Y, et al. J Biosci. 2025:50:52. PMID: 40619772. NeuroPAL reference: Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642.
|
|
| KK1216 |
C. elegans |
par-3(it298[par-3::GFP]) III. Show Description
Superficially wild-type. Made in N2 background.
|
|
| KK1218 |
C. elegans |
par-3(it300[par-3::mCherry]) III. Show Description
Superficially wild-type. Made in N2 background.
|
|
| KK1228 |
C. elegans |
pkc-3(it309[GFP::pkc-3]) II. Show Description
Superficially wild-type. Note that double homozygous mutants of pkc-3(it309) with par-2(it315) exhibited partially penetrant and variable maternal effect lethality and maternal effect sterility that was stronger than it315 alone. Thus, although the GFP tag on pkc-3 shows no effect in an otherwise wild-type background, it does seem to somewhat compromise the activity of the protein it tags. Made in N2 background.
|
|
| KK1248 |
C. elegans |
par-6(it310[par-6::GFP]) I. Show Description
Superficially wild-type. Made in N2 background. [NOTE: There was an error in the information originally submitted to the CGC for this strain. The correct allele name is par-6(it310), not par-6(it319).]
|
|
| KK1254 |
C. elegans |
par-2(it315[mCherry::par-2]) III. Show Description
par-2(it315) exhibits a weak maternal effect sterility, suggesting that the tag reduces the protein activity. Note, however, that double homozygous mutants of it315 with pkc-3(it309) or par-6(it310) exhibited partially penetrant and variable maternal effect lethality and maternal effect sterility that was stronger than it315 alone. Thus, although the GFP tags on pkc-3 and par-6 show no effect in an otherwise wild-type background, they do seem to somewhat compromise the activity of the proteins they tag. Made in N2 background.
|
|
| KK1262 |
C. elegans |
par-1(it324[par-1::GFP::par-1 exon11a]) V. Show Description
Superficially wild-type. Made in N2 background.
|
|
| KK1273 |
C. elegans |
par-2(it328[GFP::par-2]) III. Show Description
Superficially wild-type. Made in N2 background.
|
|
| KK866 |
C. elegans |
itIs153. Show Description
itIs153 [pie-1p::par-2::GFP + rol-6(su1006) + N2 genomic DNA]. Maintain at 25C. itIs153 is an integrated derivitive of axEx1094.
|
|
| KR1787 |
C. elegans |
unc-13(e51) I. Show Description
The origin of this strain is KR1082 via CB51. KR1082 was maintained on plates for a period of approximately two years. After this time, DNA was made and the Tc1 pattern examined. The number of Tc1s found in KR1787 was greater than that found in KR1082. Perhaps as many as 30 additional Tc1s were visible in excess of those normally seen in N2 strains.
|
|
| KR314 |
C. elegans |
C. elegans wild isolate. Show Description
WT var. Kitsilano. Interfertile with N2. See WBG 8(3) 78. Caenorhabditis elegans wild isolate (Tc1 pattern XII). For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).
|
|
| KRA437 |
C. elegans |
unc-3(n3435) X; kasEx147. Show Description
kasEx147 [oig-1p(1.6kb)::GFP::unc-54 3'UTR + myo-2p::GFP]. Pick worms with GFP+ pharynx to maintain array. Unc. 1.6kb cis-regulatory region (-2.6-1.0kb) upstream of oig-1 was fused to GFP with the unc-54 3'UTR. oig-1 uses mulitple cis-regulatory regions to achieve different expression patterns in motor neurons; this construct drives expression specifically in cholinergic motor neurons. Construct was injected into N2 worms. Reference: Feng W, et al. Elife. 2020 Jan 3;9. pii: e50065. doi: 10.7554/eLife.50065.
|
|
| LC105 |
C. elegans |
unc-46(e177) dpy-11(e224) uIs69 V. Show Description
uIs69 [(pCFJ90) myo-2p::mCherry + unc-119p::sid-1]. Hypersensitive neuronal RNAi by feeding. Dpy, Unc. Maintain 15-20 degrees. [NOTE: uIs69 is closely linked and maps to the right of dpy-11. (C. Loer 08/2011)] Derived from (BC277 x N2 Male) x TU3401. Reference: Calixto et al. (2010) Nature Methods 7:554-9.
|
|
| LC108 |
C. elegans |
uIs69 V. Show Description
uIs69 [(pCFJ90) myo-2p::mCherry + unc-119p::sid-1]. Hypersensitive neuronal RNAi by feeding. Superficially wild-type. Maintain 15-20 degrees. [NOTE: uIs69 is closely linked and maps to the right of dpy-11. (C. Loer 08/2011)] Derived from (unc-46(e177) uIs69) x N2 Male. Reference: Calixto et al. (2010) Nature Methods 7:554-9.
|
|
| LC141 |
C. elegans |
him-8(e1489) IV; cat-4(e3015) V. Show Description
Reduction in serotonin and dopamine, most apparent in young larva; bleach hypersensitivity and cuticle fragility in adult, but less than null mutants. Derived by outcrossing CB7107 six times to N2. Reference: Loer CM, et al. Genetics. 2015 May;200(1):237-53.
|
|