| PHX1941 |
C elegans |
ser-7(syb1941[ser-7::T2A::mNeonGreen]) X. Show Description
Endogenous ser-7 locus tagged with mNeonGreen. Inclusion of the T2A self-cleaving peptide allows mNeonGreen406
to be expressed as a cytosolic protein. Generated in N2 background. Reference: Dag U, et al. bioRxiv 2023.01.15.524132; doi: https://doi.org/10.1101/2023.01.15.524132.
|
|
| PHX5791 |
C. elegans |
pop-1(syb5791[GFP::AID*::GGGGSGSGS linker::pop-1]) I. Show Description
GFP and AID* tags inserted at the N-terminus of the endogenous pop-1 locus by CRISPR. Insertion includes a GGGGSGSGS linker sequence between the tags and POP-1. Generated in N2 background.
|
|
| PMD150 |
C. elegans |
utsIs4. Show Description
utsIs4 [nhr-49p::nhr-49::GFP + myo-2p::mCherry]. Strain was back-crossed to N2 following transgene integration (parental strain described in Ratnappan R, et al. PLoS Genet. 2014 Dec 4;10(12):e1004829. doi: 10.1371/journal.pgen.1004829. ). Reference: Watterson A, et al. Nature. 2022 May;605(7911):736-740. doi: 10.1038/s41586-022-04729-7. PMID: 35585236.
|
|
| PS4997 |
C. elegans |
unc-119(e2498) III; syIs179. Show Description
syIs179 [N2 genomic DNA (45 ng/uL) + unc-119(+) (1 ng/uL) + lin-4p::YFP (PCR fusion) (1 ng/uL)(100:1)]. lin-4 promoter primers: GCGATATTTTGCTCGATTCC, ACAGGCCGGAAGCATAAACT. Do not distribute this strain; other labs should request it from the CGC.
|
|
| PX725 |
C elegans |
fxSi8 I. Show Description
fxSi8 [synthetic guide site1::3'(delta)HygR::unc-54 3' UTR::LoxN (I:2851003)]. fxSi8 is a CRISPR-engineered site in the N2 background for future transgene insertion via CRISPR utilizing a synthetic guide site (GTTTGAGTAGAGCACTCAGGAGG) with a split hygromycin resistance selection marker; fxSi8 also introduced a small deletion of genomic sequence at the insertion site (I:2851004-2851014).
|
|
| PX736 |
C elegans |
fxSi13 III. Show Description
fxSi13 [synthetic guide site1::3'(delta)HygR::unc-54 3' UTR::Lox2272 (III:10158855)]. fxSi13 is a CRISPR-engineered site in the N2 background for future transgene insertion via CRISPR utilizing a synthetic guide site (GTCCAGCGGCAGATCGGCGGAGG) with a split hygromycin resistance selection marker; fxSi13 also introduced a small deletion of genomic sequence at the insertion site (III:10158856-10158894).
|
|
| PY12101 |
C.elegans |
oyIs96. Show Description
oyIs96 [gcy-8p::FlincG3 gcy-8p::myr::TagRFP + unc-122p::dsRed]. Red fluorescence in coelomocytes and faint green fluorescence in AFD head neurons. cGMP fluorescent sensor (FlincG3) expression in AFD neurons allows visualization of AFD signaling. Generated in N2 background. Reference: Extrachromosomal array used in the generation of this strain detailed in https://doi.org/10.1534/genetics.119.302392.
|
|
| PY1463 |
C. elegans |
oyEx45. Show Description
oyEx45 [nhr-82::GFP + coelomocyte::GFP]. N2 line injected. Maintain by picking GFP+.
|
|
| PY1466 |
C. elegans |
oyEx38. Show Description
oyEx38 [nhr-77::GFP, coelomocyte::GFP]. N2 line injected. Maintain by picking GFP+.
|
|
| QG1 |
C. elegans |
qgIR1 (X, CB4856>N2) X. Show Description
qgIR1 (X, CB4856>N2, haw102573 to 4,822,488) X. The strain is a nearly isogenic line that carries the CB4856 version of npr-1 in an otherwise N2 genetic background. NIL derived from RIAIL QX58 linked then unlinked to mec-2 from CB3273 lon-2 mec-2, then backcrossed to lon-2 for 12 generations selecting nonLon worms, then homozygosed. Genotyped N2 at pkP6106 and pkP6145. Based on QG613 sequencing, interval is from X:4,754,307-4,864,273.
|
|
| QV224 |
C. elegans |
dvIs19 III; skn-1(zj15) IV. Show Description
dvIs19 [(pAF15) gst-4p::GFP::NLS] III. Hypomorphic allele of skn-1 that may be propagated as a homozygote. High rate of embryonic lethality and slightly lower brood size compared to N2. Reference: Tang L, Dodd W, Choe K. G3 (Bethesda). 2015 Dec 29.
|
|
| QV225 |
C. elegans |
skn-1(zj15) IV. Show Description
Hypomorphic allele of skn-1 that may be propagated as a homozygote. High rate of embryonic lethality and slightly lower brood size compared to N2. Reference: Tang L, Dodd W, Choe K. G3 (Bethesda). 2015 Dec 29.
|
|
| QX1409 |
C. elegans |
qqIR7 (I: peel-1(qq99), EG4348>N2); ttTi5605 II; unc-119(ed3) III. Show Description
Nonsense allele of peel-1 carried in Utah isolate EG4348 crossed into N2 Bristol background. Reference: Seidel HS et al. PLoS Biol. 2011 Jul;9(7):e1001115.
|
|
| RB1284 |
C. elegans |
C30F12.6(ok1381) I. Show Description
C30F12.6 Homozygous. Outer Left Sequence: gtataacacaagcctccgcc. Outer Right Sequence: ggagttccagccattgatgt. Inner Left Sequence: ttttcggtctctaaccacgg. Inner Right Sequence: ttggttcaaagctgttgctg. Inner Primer PCR Length: 3260. Estimated Deletion Size: about 2200 bp. Breakpoint data provided by Neline Kriek 10/2004: TTCTTTGTAAATAACTTTTTACTTTACGTTTTTGAAAACATTCTCGATCTCCAAATCTT CbreakpointATTGGTAATTAAAATCAATAATTTCGATTCAGTGTGATCCCACTTAAA TTTTATACATTG. [NOTE: (March 2019) The Moerman lab confirms that diagnostic PCR with one primer internal to the deletion and one external yields the expected product from N2 and no product from RB1284. Primer sequences (5'->3') were ttttcggtctctaaccacgg and gaaacaagcccactcactac.] Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RG3000 |
C. elegans |
sra-34(ve500[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Show Description
Homozygous viable. Deletion of 1822 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: GAATTAATACAAACAACAGGAGCTGGAACA ; Right flanking sequence: gaaggtattgaataaaacgcggaagttcta. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3001 |
C. elegans |
sra-36(ve501[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Show Description
Homozygous viable. Deletion of 1620 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: acggcatttactcacagaaaatgggaatat ; Right flanking sequence: cgcttcaaagtttgtaatttgaaatttgaa. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3002 |
C. elegans |
sra-1(ve502[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Show Description
Homozygous viable. Deletion of 1018 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: caaatacaaaaaactgtatttaagatgtaa ; Right flanking sequence: taccaacatgcatgtttcaagaaatctaga. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3003 |
C. elegans |
sra-3(ve503[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Show Description
Homozygous viable. Deletion of 1704 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: cagcgtgagaaaaatatcagaatgtgatcg ; Right flanking sequence: gtgggagattctatcaagagaattcactga. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3004 |
C. elegans |
sra-4(ve504[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Show Description
Homozygous viable. Deletion of 1294 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ggtgtgaaagattttaaataaacaccctcg ; Right flanking sequence: CAAGGACATtctttaaaagtaaaaagaacc. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3006 |
C. elegans |
sra-31(ve506[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Show Description
Homozygous viable. Deletion of 1008 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: gttttattttttaaatacCGTCATAAAAGC ; Right flanking sequence: CCAGGAATTTCCATtttagctgatatagat. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3007 |
C. elegans |
sra-28(ve507[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Show Description
Homozygous viable. Deletion of 3237 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: aggaaaattaaatttcaattttcttgttcc ; Right flanking sequence: ggaggtgttagcttttaaaatatgactggt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3008 |
C. elegans |
sra-29(ve508[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Show Description
Homozygous viable. Deletion of 1279 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: agtattcactctttgttgtctttaccgaca ; Right flanking sequence: GCAAAAGGTTTTTGGTACAAAATGGAAATA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3009 |
C. elegans |
sra-20(ve509[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Show Description
Homozygous viable. Deletion of 1413 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TTGTCGAAAGCTTAAGATGCGCTTCCGAAG ; Right flanking sequence: ctatcaatcctccttctttattttatcatt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3010 |
C. elegans |
sra-18(ve510[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Show Description
Homozygous viable. Deletion of 2034 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: GAAATTGTGCTTCGGAAAGTCTCACCAATG ; Right flanking sequence: gtggggctcgacgtcaaggttttatttatt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3011 |
C. elegans |
sra-17(ve511[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Show Description
Homozygous viable. Deletion of 1733 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CGAGCTCCTCGAGAGCTTGAAATGCGCCTC ; Right flanking sequence: ATTGGAGTGATGACATCAATGTACGGAGAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3012 |
C. elegans |
sra-27(ve512[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Show Description
Homozygous viable. Deletion of 1310 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ctcttagtattattattatttgttccccct ; Right flanking sequence: GGAGGAGTATATGGAAATCTATCAATTCCT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3013 |
C. elegans |
sra-22(ve513[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Show Description
Homozygous viable. Deletion of 1577 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ttaccgtcaacgctatcattaatttcatcc ; Right flanking sequence: gaaggcgaggcaagacgatttttctgtttt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3014 |
C. elegans |
sra-37(ve514[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Show Description
Homozygous viable. Deletion of 2317 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: aaaaataaTTATACTGACGCGTATTTGCTG ; Right flanking sequence: CATtatggtctcatgaagtgctgctggaaa. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3015 |
C. elegans |
sra-12(ve515[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Show Description
Homozygous viable. Deletion of 1064 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AGTATTAGTGGAGCCAGAGAAACACAGGCA ; Right flanking sequence: CACGGGTACTTATTAATGGATAACACGAGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3016 |
C. elegans |
sra-26(ve516[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Show Description
Homozygous viable. Deletion of 1961 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ACGTTTCATATGAGAATCCAGATCTCCATA ; Right flanking sequence: GTTCAGTAGTTTTATTCATtttgtgcttaa. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3017 |
C. elegans |
sra-9(ve517[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Show Description
Homozygous viable. Deletion of 1190 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ttcagtttcaagatttcATGGCTACCATAG ; Right flanking sequence: ataggctgaaccaaaaaagtacatcgagtt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3018 |
C. elegans |
sra-39(ve518[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Show Description
Homozygous viable. Deletion of 2040 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TGAATTCGGTCTTGCCTCTTTTTTCCTAAC ; Right flanking sequence: TGAGGTACCTTGAAAAATAATAGCAAATAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3019 |
C. elegans |
sra-32(ve519[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Show Description
Homozygous viable. Deletion of 1878 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: gtcaaatatgttccagtttttataccactc ; Right flanking sequence: ggtggttttgattattaatgggagcaaaaa. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3020 |
C. elegans |
sra-24(ve520[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Show Description
Homozygous viable. Deletion of 1150 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CCGAAGGTCTCACCAATGCATTGACCTCGA ; Right flanking sequence: CTTGGCGTTAATTATTTGAGAATATTCAAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3021 |
C. elegans |
sra-33(ve521[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Show Description
Homozygous viable. Deletion of 2545 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: aaaaatcatcaaaatTCATTTATTCCACAT ; Right flanking sequence: gcacaaataatatgtgaaaaggggaacctt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3022 |
C. elegans |
sra-21(ve522[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Show Description
Homozygous viable. Deletion of 1748 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: tagagcagaaaccacacatctgctcacaga ; Right flanking sequence: tctggactgttattgaaagttttacgggtg. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3023 |
C. elegans |
sra-30(ve523[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. Show Description
Homozygous viable. Deletion of 175 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ctgaaacagtaaattattaactaacCTGAA ; Right flanking sequence: TGAATTCATTGCCTCGAGAATTCCAGAAGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3024 |
C. elegans |
sra-38(ve524[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X. Show Description
Homozygous viable. Deletion of 1918 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AATAGCAATGATGAAAACATTAGTGGCATA ; Right flanking sequence: GGTGGTGATAGAGAAGTCCGTTTGACTCAC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3025 |
C. elegans |
sra-25(ve525[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I. Show Description
Homozygous viable. Deletion of 1944 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AGTGTGTTTGGTGAATTCCGTTTTCCACCA ; Right flanking sequence: atgacaatttctggatttttgggtacatct. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3026 |
C. elegans |
sra-7(ve526[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Show Description
Homozygous viable. Deletion of 1486 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: tttcacagtccgttgacttttgatgcaatt ; Right flanking sequence: ACAGGATTCGTTCTTCACATGTTAGCCGAG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3027 |
C. elegans |
C40H5.2(ve527[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X. Show Description
Homozygous viable. Deletion of 1675 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ccaggcaatgatcaacgATGTACGCCTTAT ; Right flanking sequence: TCTGGAAGATCTTGAAGACTCTGCCATTCT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3028 |
C. elegans |
C40H5.7(ve528[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X. Show Description
Homozygous viable. Deletion of 939 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CTGTGAGCGAATTGTTAAATGGAGTGGCTT ; Right flanking sequence: atcacatgtcatatacagtattccattaaa. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3029 |
C. elegans |
C34C6.3(ve529[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Show Description
Homozygous viable. Deletion of 1562 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: aatgattttcagttcagATGCCTTCCTCTG ; Right flanking sequence: TATGGAACACAACAAGATGGTAGATCAATT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3030 |
C. elegans |
C46F4.3(ve530[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X. Show Description
Homozygous viable. Deletion of 794 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ATCTTACTTTCCGTTTCTGCAAAACAAGTG ; Right flanking sequence: GGAGGAGTCTGCAGACCGTCGACAAAGTGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3031 |
C. elegans |
F53C11.9(ve531[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Show Description
Homozygous viable. Deletion of 349 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: aattctcattgagaacatttcaacacacaa ; Right flanking sequence: CAAGGATTTGTTGTTGATTCAAATACCAAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3032 |
C. elegans |
igeg-1(ve532[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. Show Description
Homozygous viable. Deletion of 2773 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AATTTGGTCTTTCGATCCAATAACGTTGAA ; Right flanking sequence: AACGGAACATCAGATTCAAAACTGCTCGAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3033 |
C. elegans |
igeg-2(ve533[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X. Show Description
Homozygous viable. Deletion of 1425 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TGTTAATAGTTGTCGTCGAGTACTTGGAGT ; Right flanking sequence: TGTGGTTCCCGTGTGTGTTCCTTcttaaat. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3034 |
C. elegans |
+/nT1[umnIs49] IV; C37C3.7(ve534[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/nT1 V. Show Description
umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Homozygous Ste, Mig. Deletion of 1217 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, Ste Mig GFP+ non-mKate2 (ve534 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs. Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: GAAGTCGATGCCGTTCTGCAGTATCCTTCA ; Right flanking sequence: TACAATGACAAATCCCTCCAGCATAGATTC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3035 |
C. elegans |
nas-17(ve535[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Show Description
Homozygous viable. Deletion of 1433 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AATCACTTCGACATGTTTCTTCGACCATCT ; Right flanking sequence: TACGGAAGCAGCAAGTTGACAATTCATTAC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3036 |
C. elegans |
irg-7(ve536[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X. Show Description
Homozygous viable. Deletion of 5265 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ccTTAGTTGTTGATACAGTAGACACCTCCA ; Right flanking sequence: GCTACAATTGTAACGTAGTCAACGCTAAGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|