Strain Information
Name | JCB456 View On Wormbase |
---|---|
Species | C. elegans |
Genotype | algn-12(bet74) V/nT1[qls51] (IV;V). |
Description | Homozygous sterile. Balanced by nT1[qIs51]. Deletion of 3471 bp in parental strain N2. Left flanking sequence: tgatcactcacagttccctgg; Right flanking sequence: gaatggatatgatgatgtatat. sgRNA #1: atgttcgtggaacgacacca; sgRNA #2: aggataaactctctcttgaa. |
Mutagen | Crispr/Cas9 |
Outcrossed | x2 |
Made by | Bettinger lab |
Laboratory | JCB |
Reference | n/a |
Sign in
or
register an account if you want to order this strain.