Strain Information

Name JCB456   View On Wormbase
Species C. elegans
Genotypealgn-12(bet74) V/nT1[qls51] (IV;V).
DescriptionHomozygous sterile deletion balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP bet74 homozygotes (sterile). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. bet74 is a 3471 bp in algn-12. Generated in parental strain N2. Left flanking sequence: tgatcactcacagttccctgg; Right flanking sequence: gaatggatatgatgatgtatat. sgRNA #1: atgttcgtggaacgacacca; sgRNA #2: aggataaactctctcttgaa.
MutagenCrispr/Cas9
Outcrossedx2
Made byBettinger lab
Laboratory JCB
Reference n/a
Sign in or register an account if you want to order this strain.