Strain Information
| Name | JCB456 View On Wormbase |
|---|---|
| Species | C. elegans |
| Genotype | algn-12(bet74) V/nT1[qls51] (IV;V). |
| Description | Homozygous sterile deletion balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP bet74 homozygotes (sterile). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. bet74 is a 3471 bp in algn-12. Generated in parental strain N2. Left flanking sequence: tgatcactcacagttccctgg; Right flanking sequence: gaatggatatgatgatgtatat. sgRNA #1: atgttcgtggaacgacacca; sgRNA #2: aggataaactctctcttgaa. |
| Mutagen | Crispr/Cas9 |
| Outcrossed | x2 |
| Made by | Bettinger lab |
| Laboratory | JCB |
| Reference | n/a |
Sign in
or
register an account if you want to order this strain.