Search Strains

More Fields See WormTagDB for other published tagged loci.
Strain Species Genotype Add
SX621 C. elegans lin-15B&lin-15A(n765) X; mjIs27. Show Description
mjIs27 [mir-124p::GFP + lin-15(+)]. GFP expression in ~40 neurons, most of which are ciliated sensory neurons (AWC, AWA, AWB, ASH, ASI, ASK, PVQ (not ciliated), ASE, PHA, PHB, PVD (not ciliated), IL1, ADE, PDE). Reference: Clark AM, et al. Nucleic Acids Res. 2010 Jun;38(11):3780-93.
SYS1008 C. elegans ujIs113 II; M03D4.4(dev248) IV. Show Description
ujIs113 [pie-1p::mCherry::H2B::pie-1 3'UTR + nhr-2p::mCherry::his-24::let-858 3’UTR + unc-119(+)] II. M03D4.4(dev248) is a large CRISPR/Cas9-engineered deletion removing exons 4-6 and most of exon 7. Forward: 5'-CAATAGTCTATCTTCTAATAGTATTGGTTCCA-3' , Reverse: 5'-TGCAAGACAATAATTTGTCGGACTA-3'.
SZ197 C. elegans unc-73(e936) I; prp-8(az50) III. Show Description
prp-8(az50) is a T524S missense allele that affects cryptic splicing (5'ss choice) of unc-73(e936) to allow more UNC-73 protein to be produced. PRP-8 is the largest protein in the spliceosome (essential) with a role in all stages of splicing. Reference: Mayerle M, et al. Proc Natl Acad Sci U S A. 2019 Feb 5;116(6):2193-2199. doi: 10.1073/pnas.1819020116. PMID: 30674666.
SZ340 C. elegans smg-4(az152) V. Show Description
CRISPR/Cas9 engineered smg-4 null allele. smg-4(az152) allele is confirmed NMD-defective by both the presence of the protruding vulva phenotype and the accumulation of NMD-targeted isoforms. smg-4(az152) is easy to track in crosses by PCR and digestion with BstBI (see S1 text of Suzuki, et al. for sequence of allele) and essentially mimics ma116 in having a G->A mutation at the last base of intron 1. az152 also removes two bases of exon 2 and inserts 50nt in exon 2. Reference: Suzuki JMNGL, et al. PLoS Genet. 2022 Feb 10;18(2):e1010028. doi: 10.1371/journal.pgen.1010028. PMID: 35143478.
TBD307 C.elegans dhc-1(he255[epdz::mCherry::dhc-1]) I; utdSi51 II. Show Description
utdSi51[mex-5p::tomm-20(aa 1-55)::halotag::lov::tbb-2 3’UTR] II. Maintain at 23C and protect from light. Strain is sickly, seems to grow best and lay more eggs at 23C. Upon stimulation with 488nm light, the LOV-ePDZ optogenetic system will recruit mitochondria to the dynein heavy chain in the worm embryo. Embryonic cell divisions can be stopped by if mitochondrial recruitment is stimulated in early development. Room light can also induce mitochondria re-localization and cause infertility; store this strain in the dark. Reference: Fan X, et al. G3 (accepted).
TG11 C. elegans cep-1(lg12501) I; unc-119(ed4) III; gtEx2. Show Description
gtEx2[CEP-1::GFP + unc-119(+)]. GFP expression in germ line of adult worms (20-40 hours post L4) in the late pacytene area in the nucleus. Also expression in alae and a few nuclei in the pharynx. Compound microscope needed to see staining. Maintain by picking non-Unc.
TG12 C. elegans cep-1(lg12501) I; unc-119(ed4) III; gtIs1. Show Description
gtIs1[CEP-1::GFP + unc-119(+)]. GFP expression in germ line of adult worms (20-40 hours post L4) in the late pacytene area in the nucleus. Also expression in alae and a few nuclei in the pharynx. Compound microscope needed to see staining.
TG1890 C. elegans mus-81(tm1937) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III); xpf-1(tm2842) II. Show Description
Segregates WT GFP+ heterozygotes, non-GFP mus-81; xpf-1 double homozygotes, very rare GFP+ homozygous hT2, and dead eggs. Maintain by picking wild-type GFP+ to retain balanced strain: 15-25% of mus-81; xpf-1 double homozygotes are viable. unc-119(ed3) has likely been lost through outcrossing, but could still be present in the background. Reference: Agostinho A, et al. PLos Genetics 2013.
TG2228 C. elegans polq-1(tm2026) III. Show Description
Superficially wild-type. Deletion site verified by PCR. Reference: Muzzini DM, et al. DNA Repair (Amst.) 2008 Jun 1;7(6):941-50.
TG2452 C. elegans mus-81(tm1937) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III); xpf-1(tm2842) II; gtIs2512. Show Description
gtIs2512 [pie-1p::his-11::GFP + unc-119(+)]. Segregates WT GFP+ heterozygotes, non-GFP mus-81; xpf-1 double homozygotes, very rare GFP+ homozygous hT2, and dead eggs. Maintain by picking wild-type GFP+ to retain balanced strain: 15-25% of mus-81; xpf-1 double homozygotes are viable. unc-119(ed3) has likely been lost through outcrossing, but could still be present in the background. Reference: Agostinho A, et al. PLos Genetics 2013.
TG2454 C. elegans slx-1(tm2644) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III); xpf-1(tm2842) II; gtIs2512. Show Description
gtIs2512 [pie-1p::his-11::GFP + unc-119(+)]. Segregates WT GFP+ heterozygotes, non-GFP slx-1; xpf-1 double homozygotes, very rare GFP+ homozygous hT2, and dead eggs. Maintain by picking wild-type GFP+ to retain balanced strain: 15-25% of slx-1; xpf-1 double homozygotes are viable. unc-119(ed3) has likely been lost through outcrossing, but could still be present in the background. Reference: Agostinho A, et al. PLos Genetics 2013.
TH30 C. elegans unc-119(ed3) ruIs32 III; ddIs6 V. Show Description
ddIs6 [tbg-1::GFP + unc-119(+)]. ruIs32 [pie-1p::GFP::H2B + unc-119(+)] III. unc-119(ed3) mutation might have been lost during crossing of TH27 and AZ212.
TJ119 C. elegans Show Description
Mean lifespan 12.3 days. Carries Ts of BergBO. Carries Daf+ of N2. Males fertile. One of the shortest lived strains. No fertility at 25C.
TM151 C. elegans sod-2(sj173) I; daf-2(e1370) III; sod-3(sj134) X. Show Description
Hypersensitive to Paraquat. Growth arrest under hyperoxia (90% oxygen) at any larval stage. Reference: Honda Y, Tanaka M, Honda S, (2008) Exp Gerontol 43:520-9.
TN145 C. elegans him-8(e1489) IV; adt-1(cn30) X. Show Description
Morphological changes in the rays, especially transformation of ray 6 into a thickened shape. Appearance of abnormal protuberances around rays. Closed structure of the fan. Impaired mating ability. Exons 8-10 of the adt-1 gene, encoding most of the metalloproteinase domain of ADT-1, are deleted in adt-1(cn30).
TT3412 C. sp. 70 Caenorhabditis sp. 70 wild isolate. Show Description
Male-female. Maintain at 20C or warmer; grows faster at 25C. Isofemale line isolated from rotting banana stem at Saguna Baug, Neral, India on 1 Dec 2022. GPS 19.0425, 73.3261. 18S closest to C. parvicauda (2022). Easier to culture and freeze than C. parvicauda; freeze with DMSO/Dextran protocol. Reference: Devi, et al., in preparation.
TU1366 C. elegans deg-1(u506) X. Show Description
Recessive gain-of-function. Codon 393 changed from alanine (GCT) to threonine (ACT). Deg and Tab at all temperatures. Lethal at 15C (embryos arrest at the two-fold stage, larvae survive).
TU166 C. elegans mec-8(u314) I. Show Description
Reference: Lundquist and Herman 1994 Genetics 138: 83.
TV25205 C. elegans rab-3(wy1332[mScarlet-I::FLPon::rab-3B]) II; wyIs891 III; syd-2(wy1052[GFP::syd-2]) X. Show Description
wyIs891 [unc-86p::FLP + odr-1p::RFP] III. mScarlet-I::FLPon tag inserted into endogenous rab-3 locus specifically tagging isoform B, which is most abundant in neurons. GFP tag inserted into N-terminus of endogenous syd-2 locus. Reference: McDonald NA, et al. Nature. 2020 Dec;588(7838):454-458. PMID: 33208945.
TX773 C. elegans teIs65 II; unc-119(ed3) III; him-3(e1147) IV. Show Description
teIs65 [pie-1p::GFP::plk-1(PBD) + unc-119(+)] II. Maintain at 25 degrees and by picking the most brightly fluorescing animals to avoid silencing of the transgene. teIs65 contains GFP fused to the PLK-1 protein-binding domain. Derived from injection of pRL1216. Reference: Nishi Y, et al. Development. 2008 Feb;135(4):687-97.
TX796 C. elegans unc-119(ed3) III; him-3(e1147) IV; teEx321. Show Description
teEx321[pRL1636 (Pmed-1::GFP::sys-1) pDPmm016]. GFP signal is very weak and can't be see using a dissecting microscope. Very low transmission. Most signal is nuclear and the signal is stronger in the posterior sister, e.g., MSp stronger than MSa, Ep stronger than Ea. Some cortical signal was also detected. Some larvae lack anterior gut or have gaps. Maintain by picking non-Uncs.
TY1077 C. elegans C25D7.12(y128) unc-76(e911)/sdc-3(y52) unc-76(e911) V; xol-1(y9) X. Show Description
Heterozygotes are Unc and segregate Uncs, Dpy Uncs [C25D7.12(y128) unc-76(e911) homozygotes], and Tra Uncs [sdc-3(y52) unc-76(e911) homozygotes]. Do not distribute this strain; other labs should request it directly from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
TY1312 C. elegans unc-42(e270) yDf9 V/nT1 [let-?(m435)] (IV;V). Show Description
Heterozygotes are WT and throw WT and dead eggs. yDf9 homozygotes arrest as dead eggs.
TY1313 C. elegans yDf11 V/nT1 [let-?(m435)] (IV;V). Show Description
Heterozygotes are WT and segregate WT and dead eggs. yDf11 homozygotes arrest as dead eggs.
TY1353 C. elegans yDf10 unc-32(e189)/unc-93(e1500) dpy-17(e164) III. Show Description
Heterozygotes are Unc-93 and segregate more Unc-93, yDf10 homozygotes (dead eggs) and Unc-93 Dpy-17 homozygotes (young dpy-17 larvae are easily recognizable as abnormal spindle-shaped things). Difficult to maintain and use. yDf10 apparently causes semi-sterility (a second strain constructed by the Mark Edgley at the CGC, yDf10/qC1, exhibits same sterility), and unc-93 is Egl and difficult to mate into. Some Df homozygotes are laid, but most remain inside the mother.
TY1388 C. elegans C25D7.12(y128)/sdc-3(y52) unc-76(e911) V. Show Description
Heterozygotes are WT and segregate WT, Dpys [C25D7.12(y128) homozygotes], and Tra Uncs [sdc-3(y52) unc-76(e911) homozygotes]. Do not distribute this strain; other labs should request it directly from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
TY156 C. elegans unc-30(e191) dpy-4(e1166) IV; yDp1 (IV;V;f). Show Description
Animals with the Dup are WT. Animals which have lost the Dup are DpyUnc. Maintain by picking WT.
TY1909 C. elegans yDp4/+ (X;A); kynu-1(e1003) unc-9(e101) X. Show Description
Animals heterozygous for yDp4 are Dpy non-Flu non-Unc. Animals which have lost yDp4 are FluUnc. Animals homozygous for yDp4 are dead (embryonic lethal). Low percentage of non-Dpy non-Unc progeny. These give a high percentage of Unc male self-progeny and are inferred to be yDp4 XO hermaphrodites.
TY1912 C. elegans yDp7/+ (X;A); lon-2(e678) unc-9(e101) X. Show Description
Animals heterozygous for yDp7 are Lon non-Unc. Animals which have lost yDp7 are LonUnc. Animals homozygous for yDp7 are Dpy and sick hermaphrodites. yDp7/+ XO males are Dpy and infertile. yDp7 attached to an autosome.
TY1913 C. elegans yDp8/+ (X;A); lon-2(e678) unc-9(e101) X. Show Description
Animals heterozygous for yDp8 are Lon non-Unc hermaphrodites. Animals which have lost yDp8 are LonUnc. Animals homozygous for yDp8 are Dpy and sick hermaphrodites. yDp8/+ XO males are Dpy and infertile.
TY1915 C. elegans yDp10/+ (X;A); lon-2(e678) unc-9(e101) X. Show Description
Animals heterozygous for yDp10 are Lon non-Unc hermaphrodites. Animals which have lost yDp10 are LonUnc. Animals homozygous for yDp10 are Dpy and sick hermaphrodites. yDp10/+ XO animals are Dpy and infertile males.
TY1917 C. elegans lon-2(e678) unc-9(e101) X; yDp12 (X;f). Show Description
Free duplication. Animals with yDp12 are Lon non-Unc hermaphrodites. Animals which have lost yDp12 are LonUnc. yDp12/+ XO animals are fertile males.
TY1936 C. elegans dpy-30(y228) V/nT1 [unc-?(n754) let-?] (IV;V). Show Description
Heterozygotes are Unc and segregate Unc, dead eggs and temperature sensitive Dpys. At 15C the y228 homozygotes (derived from heterozygous mothers) are WT and most of their progeny are inviable, dying as arrested embryos or as necrotic Uncoordinated and Constipated L1 larvae; a small number of animals survive and develop into Dpy, Egl adults with a protruding vulva. At 25C the y228 homozygotes (derived from a heterozygous mother) are Dpy and Egl and have a protruding vulva; progeny from these animals are inviable and die as embryos or L1 larvae. See also WBPaper00002302.
TY2071 C. elegans him-8(e1489) IV; dpy-3(e27) unc-2(e55) X; yDp16 (X;f). Show Description
non-Unc, somewhat Dpy hermaphrodites. Gives DpyUncs when yDp16 is lost.
TY2173 C. elegans mnDp66 (X;I)/yDp14 (X;I); him-8(e1489) IV; yDf17 X. Show Description
The hermaphrodites are variable in phenotype, but most are Dpyish (small) and sick. Pick these hermaphrodites to maintain the strain, since healthier animals may have picked up a suppressor mutation or gone polyploid, etc. Strain gives WT males.
TY956 C. elegans sdc-3(y132)/unc-76(e911) V. Show Description
Heterozygotes are WT and segregate WT, Unc and Dpy (sdc-3/sdc-3). sdc-3 homozygotes exhibit a strong maternal effect lethality->most progeny from homozygotes arrest as L1 larvae--about 14% escape the lethality and develop into Dpy, Egl hermaphrodites.
UDN100028 C. elegans rab-5(udn14)/tmC18 [dpy-5(tmIs1200)] I. Show Description
Must be maintained at >20 degrees; grows better at 25C. Homozygous lethal rab-5 [D135H] mutation balanced by tmC18. Balancer marked with myo-2p::Venus. Heterozygotes are WT with pharyngeal Venus fluorescence, and segregate Venus+ heterozygotes, non-Venus rab-5[D135H] homozygotes (L1 lethal), and Dpy Venus+ tmC18 homozygotes. Pick fertile wild-type Venus+ to maintain. Silent BstAPI site added in D135H for genotyping ease. Heterozygous rab-5[D135H] animals are small and have decreased locomotion. Reference: Huang et al. 2022. PMID: 35121658
UDN100049 C. elegans let-413(udn27)/tmC3[egl-9(tmIs1230)] V. Show Description
let-413 [L248P]. Variant edit. Homozygous lethal or sterile deletion balanced by tmC3. Heterozygotes are wild-type mCherry+ and segregate mCherry+ heterozygotes, udn27 homozygotes (arrest stage unknown), and mCherry+ tmC3 homozygotes (Unc-23 Lon-3). Pick viable fertile mCherry+ animals to maintain. ApoI-HF restriction site created by synonymous changes for ease of genotyping.
UDN100083 C. elegans unc-116(udn45)/qC1 [dpy-19(e1259) glp-1(q339)] nIs189 III. Show Description
Pick slightly dumpy GFP+ to maintain. Heterozygotes are slightly dumpy GFP+ (pharynx), and segregate slightly dumpy GFP+ heterozygotes, Dpy Sterile GFP+ (qC1 homozygotes), non-GFP udn45 homozygotes (early larval arrest and Unc), and a few slow-growing wild-type looking or thin GFP+ heterozygotes. These thin GFP+ animals give rise to almost exclusively GFP+ progeny; a possible interaction between unb45 and qC1 is suspected. Variant edit allele T90I. TspRI restriction site created by synonymous changes for ease of genotyping. nIs189 [myo-2::GFP] integrated in or near qC1. No recombination seen between nIs189 and qC1; fails to complement all markers on qC1.
UDN100161 C. elegans pph-5(udn91) V. Show Description
pph-5 [A48T] #2 variant edit from Fielder, et al. (2022). Includes addition of silent AvaII restriction site and silent PAM ablation. Homozygous viable and superficially wild-type. Genotype using primers Forward: accggaaattgtcccaaaat, Reverse: tttccgactttctggaggtg. Digest with AvaII restriction enzyme for resulting sizes of 401bp +403bp. Wild-type product will not be digested.
UDN100163 C. elegans pph-5(udn93) V. Show Description
pph-5 [A48A] #1 control edit for strain UDN100160 from Fielder, et al. (2022). Wild-type sequence except for addition of silent AvaII restriction site and silent PAM ablation. Homozygous viable and wild-type appearance. Genotype using primers Forward: accggaaattgtcccaaaat, Reverse: tttccgactttctggaggtg. Digest with AvaII restriction enzyme for resulting sizes of 401bp +403bp. Wild-type product will not be digested.
UDN100169 C. elegans unc-116(gk5722udn86)/qC1 [dpy-19(e1259) glp-1(q339)] nIs189 III. Show Description
Pick wild-type GFP+ to maintain. Heterozygotes are wild-type GFP+ (pharynx), and segregate wild-type GFP+ heterozygotes, Dpy Sterile GFP+ (qC1 homozygotes), and non-GFP gk5722udn86 homozygotes (larval arrest; few escapers). Derived from VC4653; selection cassette in VC4653 was removed, and then crossed with qC1 nIs189 [myo-2::GFP] balancer. nIs189 [myo-2::GFP] integrated in or near qC1. No recombination seen between nIs189 and qC1; fails to complement all markers on qC1.
UE84 C. elegans oaSi26 II; unc-119(ed3) III. Show Description
oaSi26 [par-5p::par-5(partially recoded)::par-5 3' UTR + unc-119(+)] II. MOS single copy insertion of partially recoded par-5 under its endogenous regulatory sequences to test gene dosage control and investigate crossregulation between the two par-5 loci. Reference: Mikl, M. and Cowan, CR. Cell Rep. 2014 Sep 11;8(5):1380-90.
UE88 C. elegans oaSi30 II; unc-119(ed3) III. Show Description
oaSi30 [par-5p::par-5(partially recoded)::par-5 3' UTR(splice bias) + unc-119(+)] II. MOS single copy insertion of PAR-5 under control of the PAR-5 3'UTR.2 isoform exclusively to test gene dosage control and investigate crossregulation between the two par-5 loci. Reference: Mikl, M. and Cowan, CR. Cell Rep. 2014 Sep 11;8(5):1380-90.
UE89 C. elegans oaSi31 II; unc-119(ed3) III. Show Description
oaSi31 [par-5p::par-5(partially recoded)::par-5 3' UTR(truncated) + unc-119(+)] II. MOS single copy insertion of PAR-5 under control of the PAR-5 3'UTR.3 isoform exclusively to test gene dosage control and investigate crossregulation between the two par-5 loci. Reference: Mikl, M. and Cowan, CR. Cell Rep. 2014 Sep 11;8(5):1380-90.
UE92 C. elegans oaSi34 II; unc-119(ed3) III. Show Description
oaSi34 [par-5p::par-5(partially recoded)::par-5 3' UTR(mutated splice sites, mutated proximal poly(A)site) + unc-119(+)] II. MOS single copy insertion of PAR-5 under control of the PAR-5 3'UTR.1 isoform exclusively to test gene dosage control and investigate crossregulation between the two par-5 loci. Reference: Mikl, M. and Cowan, CR. Cell Rep. 2014 Sep 11;8(5):1380-90.
UE95 C. elegans oaSi37 II; unc-119(ed3) III. Show Description
oaSi37 [par-5p::par-5(partially recoded)::par-5 3' UTR(mutated proximal poly(A)site) + unc-119(+)] II. MOS single copy insertion of PAR-5 under control of the long PAR-5 3'UTR isoforms (utr.1 and utr.2) to test gene dosage control and investigate crossregulation between the two par-5 loci. Reference: Mikl, M. and Cowan, CR. Cell Rep. 2014 Sep 11;8(5):1380-90.
UE98 C. elegans oaSi40 II; unc-119(ed3) III. Show Description
oaSi40 [par-5p::par-5(partially recoded)::par-5 3' UTR + unc-119(+)] II. MOS single copy insertion of partially recoded par-5 fused to GFP under its endogenous regulatory sequences to test gene dosage control and investigate crossregulation between the two par-5 loci. Reference: Mikl, M. and Cowan, CR. Cell Rep. 2014 Sep 11;8(5):1380-90.
UL3294 C. elegans leEx3294. Show Description
leEx3294 [sir-2.1::mCherry + R11A8.5::GFP + rol-6(su1006)]. Rollers. Array contains fosmid WRM0630dF01 with mCherry inserted before sir-2.1 STOP codon and R11A8.5 with GFP inserted just before the STOP codon. Reference: Bamps, S et al. 2009 Mech Aging Devel 130(11-12):762-70.
UL3295 C. elegans leEx3295. Show Description
leEx3295 [sir-2.1::mCherry + R11A8.5::GFP + rol-6(su1006)]. Rollers. Array contains fosmid WRM0630dF01 with mCherry inserted before sir-2.1 STOP codon and R11A8.5 with GFP inserted just before the STOP codon. Reference: Bamps, S et al. 2009 Mech Aging Devel 130(11-12):762-70.