Search Strains

More Fields See WormTagDB for other published tagged loci.
Strain Species Genotype Add
SD551 C. elegans let-60(ga89) IV. Show Description
Temperature sensitive. Nearly WT at 15C. At 20C the animals are 18% Muv and brood size is 88. At 25C the animals are 57% Muv and almost sterile (brood size is 6). Maintain at 15C.
SD63 C. elegans dpy-5(e61) unc-13(e51) I; gaDp1 (I;f). Show Description
Animals with the duplication are WT. Animals which have lost the duplication are DpyUnc. Maintain by picking WT.
SM1508 C. elegans mxl-2(tm1516) III; bar-1(ga80) X. Show Description
Most defects are similar to bar-1(ga80) single mutant animals [bar-1(ga80) hermaphrodites are usually Egl and often have a protruding vulva (Pvl), although approx. 40% of animals appear WT on plates. Also slightly Unc. In bar-1(ga80) hermaphrodites any of the six vulval precursor cells (P3.p - P8.p) can sometimes fuse with hyp7 without dividing, and P5.p - P7.p can adopt the tertiary cell fate instead of the primary or secondary fates. In addition, the neuroblast QL and its progeny migrate towards the anterior instead of the posterior, and the cell P12 usually adopts the fate of P11. bar-1(ga80) do mate, but poorly. bar-1 encodes a beta-catenin molecule and the ga80 mutation is predicted to cause an early truncation of the protein.] Increased severity of ray 1 displacement.
SM190 C. elegans smg-1(cc546) I; pha-4(zu225) V. Show Description
Dies at 15-20C with mostly dead embyros and a few dead larvae. Grows best at 24C. Survives at 25C, but worms look sick (often small and clear) and have very reduced brood sizes. [NOTE: The temperature-sensitive allele cc546 causes an M1957L change in SMG-1. The lesion is an atg>ttg transversion in exon 35. Flanking sequences follow with the mutation site indicated with a capital A: ttggtggtcggttacaaaacgatattcaaga tcactggcagtcatgagtAtggttggatcagttttaggactcggtgatcg acatttggacaatttattg The lesion is detectable via SNP-snip with the mutation causing loss of an MslI site. Primers are for a 323 bp product. Digest with MslI to 86+237 in the wild type, uncut as 323 in the mutant. DJR701(f): CAGTCGTGAGCTTTGGATGCGTGC DJR702(r): TCGGGGATACGCAGATTCTTTCCC. Pedone ... Reiner G3 (2021).]
SP1697 C. elegans dpy-1(e1) ncl-1(e1865) unc-36(e251) III; mnDp84 (III;f). Show Description
Animals with the duplication are WT. Animals which have lost the duplications are DpyUncNcl. Maintain by picking WT. Males containing mnDp84 are not fertile.
SP1707 C. elegans dpy-1(e1) ncl-1(e1865) unc-36(e251) III; mnDp86 [dpy-1(+) him-10(+) ncl-1(+) unc-36(+)] (III;f). Show Description
Animals with mnDp86 are WT. Animals which have lost mnDp86 are DpyUnc and Ncl.
SP1781 C. elegans ncl-1(e1865) unc-36(e251) III; mnDp89 [ncl-1(+) unc-36(+) unc-3(+)] (III;f). Show Description
Animals with mnDp89 are WT. Animals which have lost mnDp89 are Unc and Ncl. mnDp89 not transmitted by males. mnDp89 formed by fusing mnDp14 and mnDp84.
SP1784 C. elegans dpy-1(e1) ncl-1(e1865) unc-36(e251) III; him-8(e1489) IV; mnDp90 [dpy-1(+) ncl-1(+) unc-36(+) unc-93(+)] (III;f). Show Description
Animals with mnDp90 are WT. Animals which have lost mnDp90 are DpyUnc and Ncl. Throws males. Males containing mnDp90 are fertile. mnDp90 was derived from mnDp86.
SP1882 C. elegans dpy-1(e1) ncl-1(e1865) III; unc-3(e151) osm-1(p808) X; mnDp92 [dpy-1(+) ncl-1(+) unc-3(+) osm-1(+)] (III;X;f). Show Description
Animals with mnDp92 are WT. Animals which have lost mnDp92 are DpyUncOsm and Ncl. Males containing mnDp92 are fertile. mnDp92 was derived by fusing mnDp14 and mnDp90.
SP1911 C. elegans dpy-1(e1) ncl-1(e1865) III; unc-3(e151) osm-1(p808) X; mnDp91 (III;X;f). Show Description
Animals with mnDp91 are WT. Animals which have lost mnDp91 are DpyUncOsm and Ncl. mnDp91 derived by fusing mnDp14 and mnDp90.
SP201 C. elegans unc-4(e120) let-242(mn90)/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
Pick WT to maintain. Hets segregate WT, DpyUncs, and lethals (early larval arrest).
SP365 C. elegans unc-4(e120) mix-1(mn29)/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
Hets are WT and segregate WT, paralyzed DpyUnc and late larval arrest (unc-4 mix-1 homozygotes). Maintain by picking WT. mix-1 previously known as let-29(mn29). See also WBPaper00002999.
SP425 C. elegans mnDf14/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
Hets are WT and segregate WT, DpyUnc and kinker Uncs which arrest as L1s. Maintain by picking WT.
SP462 C. elegans dpy-1(e1) unc-36(e251) III; mnDp37[unc-32(e189)] (III;f). Show Description
Animals with the duplication are WT. Animals which have lost the duplication are DpyUnc-36.
SP544 C. elegans unc-4(e120) mnDf31/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
Hets are Dpy and segregate Dpy, DpyUnc and Unc-4s which arrest in larval development. Maintain by picking Dpy.
SP647 C. elegans unc-4(e120) mnDf75/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
Hets are WT and segregate WT, paralysed DpyUnc and Uncs which arrest in early larval development. Maintain by picking WT.
SP752 C. elegans unc-4(e120) mnDf86/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
Hets are WT and segregate WT, DpyUnc and kinker Uncs which arrest as early larvae. Maintain by picking WT.
SP789 C. elegans unc-4(e120) mnDf101/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
Hets are WT and segregate WT, paralysed DpyUnc and Unc-4 lethals that arrest at L2. Maintain by picking WT.
SPC167 C. elegans dvIs19 III; skn-1(lax120) IV. Show Description
dvIs19 [(pAF15) gst-4p::GFP::NLS] III. Oxidative stress-inducible GFP. Sma. Dominant allele of skn-1 is constitutively active and does not respond to dietary restriction. Reference: Paek J, et al. Cell Metab. 2012 Oct 3;16(4):526-37.
SPC168 C. elegans dvIs19 III; skn-1(lax188) IV. Show Description
dvIs19 [(pAF15) gst-4p::GFP::NLS] III. Oxidative stress-inducible GFP. Sma. Dominant allele of skn-1 is constitutively active and does not respond to dietary restriction. Reference: Paek J, et al. Cell Metab. 2012 Oct 3;16(4):526-37.
SS104 C. elegans glp-4(bn2) I. Show Description
Temperature sensitive defect in germ-line proliferation during larval development. Defect can be reversed by shifting worms from restrictive (25C) to permissive temperature (16C). Germ-line proliferation defect at restrictive temperature may be due to arrest in mitotic prophase. This strain is very useful for producing large populations of worms that essentially lack a germ line.
SS230 C. elegans unc-13(e51) I; him-5(e1490) V; nDp4 (I;V)/+. Show Description
Animals with the Duplication are WT. Animals which have lost the Duplication are Unc. Throws males.
SS262 C. elegans mes-3(bn35) dpy-5(e61) I; sDp2 (I;f). Show Description
Animals with the Duplication have a WT phenotype. Animals which have lost the Duplication are Dpy and give sterile Dpy progeny. Strict maternal effect sterile. Sterile worms have a dramatic reduction in number of germs cells (10-100 fold less than WT). See also WBPaper00002343.
SS747 C. elegans bnIs1. Show Description
bnIs1 [pie-1::GFP::pgl-1 + unc-119(+)]. GFP is brightest at 25C and the strain should be grown at that temperature. Routinely pick bright GFP+ worms to maintain. Because the transgene can become silenced, you should check the worms for GFP expression and freeze as soon as possible.
SS749 C. elegans deps-1(bn121) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Maintain by picking GFP+ worms. deps-1 mutants are temperature-sensitive maternal-effect sterile (>80% sterile at 24.5C). Grow these balanced worms at 25C to verify that GFP+ worms are fertile and GFP- worms (deps-1 M+Z-) produce sterile progeny (M-Z-). It is best to keep deps-1 balanced because deps-1 M-Z- animals tend to lay many dead eggs and fewer eggs than WT at lower temps (15-20C).
SSM289 C. elegans mre-11(iow45[mre-11::gfp::3xflag]) V. Show Description
Homozygous gfp and 3xflag C’ terminal tag inserting just before the STOP codon of mre-11. The strain is fertile and contains wild type germline (examined by DAPI). GFP is expressed in all germline nuclei. Maintain the strain by picking worms at 20C, no selection required. gfp::3xflag was added by CRISPR/Cas9 using pDD282-based vector. Reference: Reichman R, et al. Genetics. 2018 Apr;208(4):1421-1441.
SSM42 C. elegans let-92(ok1537) IV/nT1 [qIs51] (IV;V). Show Description
Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP gk526 homozygotes (variable arrest, early larval). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain.
ST14 C. elegans mua-5(nc14)/bli-6(sc16) egl-19(n582) unc-24(e138) IV. Show Description
Heterozygotes are WT and segregate WT, BliEglUnc, and animals with muscle attachment defects and ventral cord displacement and detachment which arrest in larval development. Not well balanced.
ST15 C. elegans ncIs2 II; mua-5(nc15)/bli-6(sc16) egl-19(n582) unc-24(e138) IV. Show Description
ncIs2 [pH20::GFP + pBlueScript]. Heterozygotes are WT and segregate WT, BliEglUnc, and animals with muscle attachment defects and ventral cord displacement and detachment which arrest in larval development. Not well balanced. Neurons visualized with ncIs2.
ST16 C. elegans ncIs2 II; mua-6(nc16)/unc-3(e151) X. Show Description
ncIs2 [pH20::GFP + pBlueScript]. Heterozygotes are WT and segregate WT, Uncs, and animals with muscle attachment defects and ventral cord displacement and detachment which arrest in larval development. Not well balanced. Neurons visualized with ncIs2.
ST17 C. elegans mua-5(nc17)/bli-6(sc16) egl-19(n582) unc-24(e138) IV. Show Description
Heterozygotes are WT and segregate WT, BliEglUnc, and animals with muscle attachment defects and ventral cord displacement and detachment which arrest in larval development. Not well balanced.
ST18 C. elegans mua-5(nc18)/bli-6(sc16) egl-19(n582) unc-24(e138) IV. Show Description
Heterozygotes are WT and segregate WT, BliEglUnc, and animals with muscle attachment defects and ventral cord displacement and detachment which arrest in larval development. Not well balanced.
ST20 C. elegans ncIs2 II; mup-4(nc20)/sma-3(e491) unc-32(e189) III. Show Description
ncIs2 [pH20::GFP + pBlueScript]. Heterozygotes are WT and segregate WT, SmaUnc, and animals with muscle attachment defects and ventral cord displacement and detachment which arrest in larval development or as embryos. Not well balanced. Neurons visualized with NcIs2.
ST21 C. elegans ncIs2 II; mup-4(nc21)/dpy-17(e164) unc-32(e189) III. Show Description
ncIs2 [pH20::GFP + pBlueScript]. Heterozygotes are WT and segregate WT, DpyUnc, and animals with muscle attachment defects and ventral cord displacement and detachment which arrest in larval development or as embryos. Not well balanced. Neurons visualized with NcIs2.
ST22 C. elegans ncIs2 II; mup-4(nc22)/dpy-17(e164) unc-32(e189) III. Show Description
ncIs2 [pH20::GFP + pBlueScript]. Heterozygotes are WT and segregate WT, DpyUnc, and animals with muscle attachment defects and ventral cord displacement and detachment which arrest in larval development or as embryos. Not well balanced. Neurons visualized with NcIs2.
ST29 C. elegans ven-2(nc29)/mnC1 [dpy-10(e128) unc-52(e444)] II; ncIs3 III. Show Description
ncIs3 [pH20::GFP + pBlueScript]. Expresses GFP in nearly all neurons. Heterozygotes are WT and segregate WT, DpyUncs, and animals with muscle attachment defects and ventral cord displacement and detachment which arrest in larval development.
ST30 C. elegans spon-1(nc30) ncIs2/dpy-10(e128) unc-53(n569) II. Show Description
ncIs2 [pH20::GFP + pBlueScript]. Heterozygotes are WT and segregate WT, DpyUnc, and animals with muscle attachment defects and ventral cord displacement and detachment which arrest in larval development. Not well balanced. Neurons visualized with ncIs2.
ST35 C. elegans ncIs2 II; mup-4(nc35)/dpy-17(e164) unc-32(e189) III. Show Description
ncIs2 [pH20::GFP + pBlueScript]. Heterozygotes are WT and segregate WT, DpyUncs, and animals with muscle attachment defects and ventral cord displacement and detachment which arrest as embyros or in larval development. Not well balanced. Neurons visualized with ncIs2.
SV1438 C. elegans unc-119(ed3) III; heSi141 X. Show Description
heSi141 [hlh-8(short)::FLAG::CRE::tbb-2 + unc-119(+)] X. Strain is viable at 15-25 C, but non-tissue specific recombination is observed more frequently in other tissues at higher temperatures (25C). Expression of CRE recombinase in the mesoblast lineage driven by the hlh-8 promoter. Reference: Ruijtenberg S & van den Heuvel S. Cell. 2015 Jul 16;162(2):300-13.
SV1440 C. elegans unc-119(ed3) III; heIs105 IV; heSi141 X. Show Description
heIs105 [rps-27::loxP::NLS::mCherry::let858 UTR::loxP::NLS::GFP::let-858 UTR + unc-119(+)] IV. heSi141 [hlh-8(short)::FLAG::CRE::tbb-2 + unc-119(+)] X. Maintain at 15-25C. Expression of CRE recombinase in the mesoblast lineage driven by the hlh-8 promoter. heIs105 carries a read-out construct which allows the visualization of the CRE lox mediated recombination in the mesoblast lineage by a switch from red to green. This read-out construct is silenced in the germline. Reference: Ruijtenberg S & van den Heuvel S. Cell. 2015 Jul 16;162(2):300-13.
SV1448 C. elegans fzr-1(ku298) II; unc-119(ed3) III; heSi143 IV; heSi141 X. Show Description
heSi 143 [rps-27::loxP::mCherry::let-858::fzr-1p::fzr-1::fzr-1 UTR::loxP::GFP::let-858 UTR + unc-119(+)] IV. heSi141 [hlh-8(short)::FLAG::CRE::tbb-2 + unc-119(+)] X. Maintain at 15-25C. Expression of CRE recombinase in the mesoblast lineage driven by the hlh-8 promoter. heSi143 rescues fzr-1(ku298). fzr-1 will be excised upon mesoblast-specific expression of CRE, creating a mesoblast specific mutant of fzr-1. This recombination event can be visualized by a switch from red to green in those cells (the mesoblast) were fzr-1 is lost. Reference: Ruijtenberg S & van den Heuvel S. Cell. 2015 Jul 16;162(2):300-13.
SV1450 C. elegans unc-119(ed3) III; heIs145 IV Show Description
heIs145 [rps-27::loxP::NLS::mCherry::let858 UTR::eft-3::tagBFP::tbb-2 UTR::loxP::NLS::GFP::let-858 UTR + unc-119(+)] IV. Maintain at 15-25C. heIs145 expresses a read-out construct used to visualize CRE activity and specificity, and to test whether CRE expression is likely to induce loss of a gene of interest (tagBFP in this case) in a given tissue. Expression of CRE will result in a change from mCherry to GFP and loss of tagBFP expression in those cells where CRE is active. Reference: Ruijtenberg S & van den Heuvel S. Cell. 2015 Jul 16;162(2):300-13.
SV1578 C. elegans unc-119(ed3) III; heIs105 IV; swsn-1(os22) heSi164 V; heSi141 X. Show Description
heIs105 [rps-27::loxP::NLS::mCherry::let858 UTR::loxP::NLS::GFP::let-858 UTR + unc-119(+)] IV. heSi164 [rps-27::loxN::NLS::mCherry::let858 UTR::swsn-1p::swsn-1::unc-54 UTR::loxN::NLS::GFP::let-858 UTR + unc-119(+)] V. heSi141 [hlh-8(short)::FLAG::CRE::tbb-2 + unc-119(+)] X. Maintain the line at 15C and shift to 25C for mutant analysis. Expression of CRE recombinase in the mesoblast lineage driven by the hlh-8 promoter. heSi164 carries a swsn-1 rescue construct which ensures rescue of the temperature-sensitive swsn-1(os22) mutation. Upon expression of CRE (in this case in the mesoblast lineage) the swsn-1 gene will be excised, creating a mesoblast specific mutant of swsn-1. This recombination event can be visualized by a switch from red to green in those mesoblast cells in which swsn-1 was lost. The animals are healthy at 15C, but embryonic lethal and larval arrested at 23-25C. swsn-1(os22) causes mild overproliferation in the mesoblast lineage. The swsn-1 rescuing transgene is unable to rescue germline development of swsn-1(os22) mutants. Reference: Ruijtenberg S & van den Heuvel S. Cell. 2015 Jul 16;162(2):300-13.
SV1930 C. elegans swsn-8(he273 he287 [LoxN exon 3 + LoxN last intron]) I; heSi208 V; heSi141 X. Show Description
heSi208 [eft- 3p::LoxP::NLS(egl-13)::tagBFP2::tbb-2 UTR::LoxP::NLS(egl-13)::mCherry::tbb-2 3'UTR] V. heSi141 [hlh-8p::CRE] X. he273 he287 homozygotes are Egl since they cannot form a functioning vulva due to swsn-8 inactivated in the mesoderm lineage by hlh-8p::CRE expression. LoxN sites in the endogenous swsn-8 locus facilitate inducible knockout of swsn-8. Reference: van der Vaart A, et al. Sci Adv 2020 May 20;6(21):eaay3823. PMID: 32494730
SV2002 C. elegans rnt-1(he305[rnt-1::eGFP::3xflag::loxP]) I. Show Description
eGFP and 3xFlag tags inserted into endogenous rnt-1 locus. Superficially wild-type. Reference: Horst SEM, et al. Development 2019 Nov 18;146(22):dev180034.
SV2061 C. elegans he314[pie-1p::GLO-ePDZ::mCherry::smu-1::tbb-2 3'UTR] II; e259[eft-3p::PH::eGFP::LOV::tbb-2 3'UTR]) IV. Show Description
he314[pie-1p::GLO-ePDZ::mCherry::smu-1::tbb-2 3'UTR] II. e259[eft-3p::PH::eGFP::LOV::tbb-2 3'UTR]) IV. Superficially wild-type. CRISPR/Cas9 was used to create insertion alleles he314 and he259 insertions into N2 background at sites of known MosSCI insertions ttTi5605 and cxTi10816, respectively. ePDZ–LOV system transgenes allow use of blue light to control protein heterodimerization, in this case, membrane recruitment of ePDZ-tagged proteins of interest. Germline-optimized cytosolic ePDZ::mCherry-tagged SMU-1 (GLO-ePDZ::mCherry::SMU-1), and membrane-bound LOV2 domain fused to a pleckstrin-homology domain (PH::eGFP::LOV). GLO-ePDZ::mCherry is a germline-optimized variant coded to be less prone to silencing in the germline. Reference: Fielmich LE, et al. eLife 2018 Aug 15;7:e38198. doi: 10.7554/eLife.38198.
SV2114 C. elegans pop-1(he335[eGFP::loxP::pop-1]) I. Show Description
eGFP tag inserted into endogenous pop-1 locus. The homozygous gfp::pop-1 strain is viable, although not fully healthy and occasionally missing a seam cell. Reference: Horst SEM, et al. Development 2019 Nov 18;146(22):dev180034.
SX1359 C. elegans pash-1(mj100) I; mjEx331. Show Description
mjEx331 [eft-3p::pash-1::GFP::unc-54 3'UTR + myo-2p::mCherry::unc-54 3'UTR]. Maintain at 25C. Array rescues pash-1 lethality and should be self-selecting at 25C. Pick mCherry(+) animals to confirm presence of array. SX1359 was derived from SX1137 pash-1(mj100). mj100 homozygotes can be re-isolated by raising SX1359 at permissive temperature (15C) and picking animals that have lost the array. Reference: Lehrbach NJ, et al. RNA. 2012 Dec;18(12):2220-35.
SX158 C. elegans prg-1(n4357) I; unc-22(r750) IV. Show Description
Twitching due to transposon insertion in unc-22. [(07/16/2018) NOTE: A user has reported their PCR and sequence analysis suggest this strain contains does not still contain Tc3, but retains loss unc-22 function, apparently due to imprecise excision.]
SX620 C. elegans mir-124(n4255) IV; lin-15B&lin-15A(n765) X; mjIs27. Show Description
mjIs27 [mir-124p::GFP + lin-15(+)]. GFP expression in ~40 neurons, most of which are ciliated sensory neurons (AWC, AWA, AWB, ASH, ASI, ASK, PVQ (not ciliated), ASE, PHA, PHB, PVD (not ciliated), IL1, ADE, PDE). Reference: Clark AM, et al. Nucleic Acids Res. 2010 Jun;38(11):3780-93.