| AR2 |
C. elegans |
hcp-6(mr17) unc-73(e936) I. Show Description
Unc at all temperatures. For hcp-6: 15C: no phenotype. 26C: shifted as L4 or later results in 100% embryonic lethality; shifted before L4 results in Unc and Sterile animals. Intermediate phenotypes between 20-23C. |
|
| CB2067 |
C. elegans |
unc-73(e936) dpy-5(e61) I. Show Description
UncDpy. |
|
| CB936 |
C. elegans |
unc-73(e936) I. Show Description
Severe coiler Unc. Bursae abnormal. Males abnormal. M-MATING-NO SUCCESS. |
|
| JW101 |
C. elegans |
unc-73(e936) I; sup-39(je5) II. Show Description
WT movement. Various degrees of embryonic lethality and Egl. About 1% Roll after L4. |
|
| JW102 |
C. elegans |
sup-39(je5) II. Show Description
je5 is a dominant suppressor of unc-73(e936). WT movement. Various degrees of embryonic lethality and Egl. About 1% Roller after L4. |
|
| JW103 |
C. elegans |
sup-39(je6) II. Show Description
je6 is a dominant suppressor of unc-73(e936). WT movement. Various degrees of embryonic lethality and Egl. About 1% Roller after L4. |
|
| RG3436 |
C. elegans |
srp-7(ve936[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Show Description
Homozygous viable. Deletion of 1601 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TTCCGAATCTCTCGCATTTTCTCCACTTTC ; Right flanking sequence: TTTTCAAGCAGATCATCCTTTCCTCTTTAT. srp-7 sgRNA A: CATTGCCTTAGCTCTATCTC; srp-7 sgRNA B: ACGATTGGCTTTATAGCTGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
|
| SZ155 |
C. elegans |
unc-73(e936) I; prp-8(az29) III. Show Description
prp-8(az29) is a G654E missense mutation. az29 is a CRISPR-induced mutation mimicking a known suppressor of unc-73(e936). It changes cryptic splicing of e936 to allow for an increase in full-length unc-73 expression. Reference: Mayerle M, et al. Proc Natl Acad Sci U S A. 2019 Feb 5;116(6):2193-2199. doi: 10.1073/pnas.1819020116. PMID: 30674666. |
|
| SZ197 |
C. elegans |
unc-73(e936) I; prp-8(az50) III. Show Description
prp-8(az50) is a T524S missense allele that affects cryptic splicing (5'ss choice) of unc-73(e936) to allow more UNC-73 protein to be produced. PRP-8 is the largest protein in the spliceosome (essential) with a role in all stages of splicing. Reference: Mayerle M, et al. Proc Natl Acad Sci U S A. 2019 Feb 5;116(6):2193-2199. doi: 10.1073/pnas.1819020116. PMID: 30674666. |
|
| SZ211 |
C. elegans |
snrp-27(az56) I. Show Description
snrp-27(az56) is a M141T missense allele with semi-dominant suppression of e936. No phenotype on its own. az56 is a CRISPR-induced mutation mimicking a known suppressor of unc-73(e936). This allele activates many dozens of alternative 5' splice sites in an RNA-seq experiment. snrp-27 is a component of the tri-snRNP and pre-B spliceosomal complexes. Reference: Zahler AM, et al. RNA. 2018 Oct;24(10):1314-1325.
doi: 10.1261/rna.066878.118. PMID: 30006499. |
|
| SZ299 |
C. elegans |
unc-73(e936) I; prp-8(az117) III. Show Description
prp-8(az117) is a CRISPR-engineered R540K missense allele that suppress unc-73(e936) uncoordination through activation of an in-frame cryptic 5'ss. Reference: Cartwright-Acar CH, et al. Nucleic Acids Res. 2022 Nov 11;50(20):11834-11857. doi: 10.1093/nar/gkac991. PMID: 36321655. |
|
| SZ304 |
C. elegans |
unc-73(e936) I; prp-8(az119) III. Show Description
prp-8(az119) is a D1549N missense allele. az119 is a CRISPR-induced mutation mimicking a known suppressor of unc-73(e936). az119 suppresses unc-73(e936) uncoordination through activation of cryptic splicing that promotes full length UNC-73 production. Reference: Cartwright-Acar CH, et al. Nucleic Acids Res. 2022 Nov 11;50(20):11834-11857. doi: 10.1093/nar/gkac991. PMID: 36321655. |
|
| SZ305 |
C. elegans |
unc-73(e936) I; snrp-200(az123) II. Show Description
az123 is an N18K missense allele altering 5' cryptic splicing usage. az123 is a CRISPR-induced mutation mimicking a known suppressor of unc-73(e936). Reference: Cartwright-Acar CH, et al. Nucleic Acids Res. 2022 Nov 11;50(20):11834-11857. doi: 10.1093/nar/gkac991. PMID: 36321655. |
|
| SZ345 |
C. elegans |
unc-73(e936az30) dxbp-1(az121) I; smg-4(az152) V. Show Description
dxbp-1(az121) is a K23N mutation that promotes usage of introns starting in UU when the sequence GUU is present at the 5' end of the intron. az121 was initially identified as able to suppress uncoordination of unc-73(e936) by promoting a cryptic splice site that defines an intron beginning UU. smg-4 mutant background allows for high throughput sequencing to identify frame shifted transcripts since it can move the 5'ss over by 1nt. e936az30 has no phenotype on its own, but it offers two adjacent cryptic 5'ss separated by 1nt. Reference: Suzuki JMNGL, et al. PLoS Genet. 2022 Feb 10;18(2):e1010028. doi: 10.1371/journal.pgen.1010028. PMID: 35143478. |
|
| SZ346 |
C. elegans |
prcc-1(az122) IV; smg-4(az152) V. Show Description
az122 is an I371F missense allele of dxbp-1 and presumptive null. It suppresses unc-73(e936) by promoting cryptic splicing of an intron beginning with UU. az122 is a CRISPR-induced mutation mimicking a known suppressor of unc-73(e936). smg-4(az152) provides an NMD deficient background allowing maximization of alternative splicing changes by 1nt by mRNA-Seq. Reference: Suzuki JMNGL, et al. PLoS Genet. 2022 Feb 10;18(2):e1010028. doi: 10.1371/journal.pgen.1010028. PMID: 35143478. |
|
| SZ355 |
C. elegans |
unc-73(az63) dxbp-1(az52) I; smg-4(az152) V. Show Description
az52 is a CRISPR-engineered M107I missense allele of dxbp-1. az52 has no phenotype on its own, but suppresses unc-73(e936) and unc-73(az63) by promoting use of a cryptic splice site for an intron beginning with UU. smg-4(az152) provides an NMD deficient background allowing identification of out-of-frame mis-splicing in an RNA-seq experiment. Reference: Suzuki JMNGL, et al. PLoS Genet. 2022 Feb 10;18(2):e1010028. doi: 10.1371/journal.pgen.1010028. PMID: 35143478. |
|