BE101 |
C. elegans |
sqt-1(sc101) II. Show Description
Long, weak left-handed rollers in L3 and older.
|
|
CB101 |
C. elegans |
unc-9(e101) X. Show Description
Unc.
|
|
MT2764 |
C. elegans |
unc-9(e101) lin-15B&lin-15A(n765) X. Show Description
Temperature-sensitive Lin.
|
|
MT4578 |
C. elegans |
lin-1(e1275) dpy-13(e184) IV; unc-9(e101) X. Show Description
Temperature sensitive Muv. Semi-dominant Dpy. Unc-moves backward better than forward; slight kinker in forward movement; larvae more severly Unc.
|
|
SP15 |
C. elegans |
unc-9(e101) unc-3(e151) X. Show Description
|
|
SP928 |
C. elegans |
dpy-6(e14) unc-9(e101) X. Show Description
DpyUnc.
|
|
SV411 |
C. elegans |
heDf1 maIs103/lon-2(e678) unc-9(e101) X. Show Description
maIs103[rnr::GFP unc-36(+)] X. The heDf1 deletion includes cdk-4. Heterozygotes produce 1/4 thin, sterile, uncoordinated animals that fail to undergo postembryonic somatic cell divisions. heDf1 mutants are of L1 size, smaller than cdk-4 mutants. lon-2 and unc-9 do not exactly balance heDf1, but unc-9 is pretty close. It should also be possible to follow the heterozygotes by looking at the GFP. Despite trying, unable to separate the maIs integration from heDf1 or the other cdk-4 alleles. By maintaining animals with GFP (visible especially in early animals and in eggs) you should be able to maintain heDf1. rnr::GFP is expressed during S-phase in heterozygous animals. rnr::GFP expression is not detected in heDf1 animals. maIs103 is tightly linked to heDf1. Maintain by picking several single animals and scoring for 1/4 mutant progeny.
|
|
TY1909 |
C. elegans |
yDp4/+ (X;A); kynu-1(e1003) unc-9(e101) X. Show Description
Animals heterozygous for yDp4 are Dpy non-Flu non-Unc. Animals which have lost yDp4 are FluUnc. Animals homozygous for yDp4 are dead (embryonic lethal). Low percentage of non-Dpy non-Unc progeny. These give a high percentage of Unc male self-progeny and are inferred to be yDp4 XO hermaphrodites.
|
|
TY1910 |
C. elegans |
yDp5 (X;A); lon-2(e678) unc-9(e101) X. Show Description
Lon non-Unc hermaphrodite strain. yDp5 is homozygous viable. yDp5/+ XO animals are fertile males.
|
|
TY1911 |
C. elegans |
yDp6 (X;A); lon-2(e678) unc-9(e101) X. Show Description
Lon non-Unc hermaphrodites. yDp6 is homozygous viable. yDp6/+ XO animals are fertile males.
|
|
TY1912 |
C. elegans |
yDp7/+ (X;A); lon-2(e678) unc-9(e101) X. Show Description
Animals heterozygous for yDp7 are Lon non-Unc. Animals which have lost yDp7 are LonUnc. Animals homozygous for yDp7 are Dpy and sick hermaphrodites. yDp7/+ XO males are Dpy and infertile. yDp7 attached to an autosome.
|
|
TY1913 |
C. elegans |
yDp8/+ (X;A); lon-2(e678) unc-9(e101) X. Show Description
Animals heterozygous for yDp8 are Lon non-Unc hermaphrodites. Animals which have lost yDp8 are LonUnc. Animals homozygous for yDp8 are Dpy and sick hermaphrodites. yDp8/+ XO males are Dpy and infertile.
|
|
TY1914 |
C. elegans |
yDp9 (X;A); lon-2(e678) unc-9(e101) X. Show Description
Lon non-Unc hermaphrodite strain. yDp9 is homozygous viable. yDp9/+ XO animals are fertile males.
|
|
TY1915 |
C. elegans |
yDp10/+ (X;A); lon-2(e678) unc-9(e101) X. Show Description
Animals heterozygous for yDp10 are Lon non-Unc hermaphrodites. Animals which have lost yDp10 are LonUnc. Animals homozygous for yDp10 are Dpy and sick hermaphrodites. yDp10/+ XO animals are Dpy and infertile males.
|
|
TY1916 |
C. elegans |
yDp11 (X;IV); lon-2(e678) unc-9(e101) X. Show Description
Lon non-Unc hermaphrodite strain. yDp11 is homozygous viable. yDp11/+ XO animals are fertile males.
|
|
TY1917 |
C. elegans |
lon-2(e678) unc-9(e101) X; yDp12 (X;f). Show Description
Free duplication. Animals with yDp12 are Lon non-Unc hermaphrodites. Animals which have lost yDp12 are LonUnc. yDp12/+ XO animals are fertile males.
|
|
AMP100 |
C. elegans |
ieSi57 II; rpb-2(cer135[rpb-2::GFP(delta)piRNA::AID::3xFLAG]) III. Show Description
ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. cer135 is a rpb-2::GFP(delta)piRNA::AID::3xFLAG tag inserted into the endogenous rpb-2 locus. This strain allows auxin-dependent disruption of RNA polymerase II with dose-dependent lifespan shortening. Reference: Oswal N, et al. PLoS Comput Biol. 2022 Sep 30;18(9):e1010415. PMID: 36178967.
|
|
BW1118 |
C. elegans |
mel-25(ct60) unc-42(e270)/unc-23(e25) vab-8(e1017) V; lon-2(e678) X. Show Description
Maintain by picking Lon non-Unc. Throws Lon non-Unc, Lon Unc Vab (bent head, tails very thin), and Lon Unc Mel (kinker, temperature-sterile).
|
|
BW1199 |
C. elegans |
him-8(e1489) IV; unc-42(e270) sma-1(e30) V; ctDp8[vab-8(e1017)] (V;f). Show Description
|
|
CB1017 |
C. elegans |
vab-8(e1017) V. Show Description
Degenerate tail. Posterior half is thin, pale, uncoordinated.
|
|
CSM1320 |
C. elegans |
twk-2(mac507) II. Show Description
twk-2 loss-of-function allele. Moderately deep curvature. Weakly extended backward locomotion. Frequent backward locomotion. Reference: Zhou C, et al. PLoS Genet. 2022;18: e1010126. doi:10.1371/journal.pgen.1010126. PMID: 35482723.
|
|
CSM1323 |
C. elegans |
twk-7(mac510) III. Show Description
twk-7 loss-of-function allele. Hyperactive forward locomotion. twk-7(mac510) is a 10-bp deletion and 2-bp insertion in exon 9, causing a frameshift: aatttattttcagGTAAAAAAGAACGCAGCAACGGAGACATGGACATTTTCATCGTCCATTTTCTTTGCCGTAACCGTCGTCACTACCATCGGATACGGTAATCCAGTTCCAGTGACAAACATTGGACGGATATGGTGTATATTGTTCTCCTTGCTTGGAA(TACCTCTAAC)del(AA)insACTGGTTACCATCGCTGACTTGGgtaagtgg. Reference: Zhou C, et al. PLoS Genet. 2022;18: e1010126. doi:10.1371/journal.pgen.1010126. PMID: 35482723.
|
|
CSM1331 |
C. elegans |
twk-43(mac518) V. Show Description
twk-43 loss-of-function allele. Reference: Zhou C, et al. PLoS Genet. 2022;18: e1010126. doi:10.1371/journal.pgen.1010126. PMID: 35482723.
|
|
CSM1356 |
C. elegans |
twk-26(mac525) X. Show Description
twk-26 loss-of-function allele. Reference: Zhou C, et al. PLoS Genet. 2022;18: e1010126. doi:10.1371/journal.pgen.1010126. PMID: 35482723.
|
|
CSM1358 |
C. elegans |
twk-29(mac527) I. Show Description
twk-29 loss-of-function allele. Reference: Zhou C, et al. PLoS Genet. 2022;18: e1010126. doi:10.1371/journal.pgen.1010126. PMID: 35482723.
|
|
CSM1360 |
C. elegans |
twk-30(mac529) I. Show Description
twk-30 loss-of-function allele. Extended backward locomotion. Reference: Zhou C, et al. PLoS Genet. 2022;18: e1010126. doi:10.1371/journal.pgen.1010126. PMID: 35482723.
|
|
CSM1362 |
C. elegans |
twk-35(mac531) V. Show Description
twk-35 loss-of-function allele. Reference: Zhou C, et al. PLoS Genet. 2022;18: e1010126. doi:10.1371/journal.pgen.1010126. PMID: 35482723.
|
|
CSM1364 |
C. elegans |
twk-48(mac533) III. Show Description
twk-48 loss-of-function allele. Irregular curvature. Frequent deep forward turns. Brief forward coiling upon completing backward locomotion. Reference: Zhou C, et al. PLoS Genet. 2022;18: e1010126. doi:10.1371/journal.pgen.1010126. PMID: 35482723.
|
|
CSM1366 |
C. elegans |
twk-49(mac535) II. Show Description
twk-49 loss-of-function allele. Reference: Zhou C, et al. PLoS Genet. 2022;18: e1010126. doi:10.1371/journal.pgen.1010126. PMID: 35482723.
|
|
DM1153 |
C. elegans |
ccar-1(ra14) IV. Show Description
WT in appearance and movement. Some slight body wall muscle disorganization. More severe gonad disorganization, and greatly reduced brood size. Suppresses the e444, e998, 669, e1012, e1421 and st196 alleles of unc-52.
|
|
DM1154 |
C. elegans |
ccar-1(ra5) IV. Show Description
WT in appearance and movement. Some slight body wall muscle disorganization. More severe gonad disorganization, and greatly reduced brood size. Suppresses the e444, e998, 669, e1012, e1421 and st196 alleles of unc-52.
|
|
EU3095 |
C elegans |
aspm-1(or1935[GFP::aspm-1]) I; zyg-9(or1984) II; ltIs37 IV. Show Description
ItIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. Maintain at 15C. Fast-acting temperature-sensitive allele. At restrictive temperature (26C), animals give rise to 100% dead embryos. At 15C, animals give rise to viable progeny. GFP::aspm-1 localizes to meiotic spindle poles and centrosomes during early development. Might still carry unc-119(ed3) III in background. Reference: Harvey AM, et al. PLoS Genet. 2023 Jan 6;19(1):e1010363. doi: 10.1371/journal.pgen.1010363. PMID: 36608115
|
|
EU3407 |
C elegans |
zyg-9(or1985)/mnC1[dpy-10(e128) unc-52(e444) umnIs32] II. Show Description
umnIs32 [myo-2p::GFP + NeoR, II: 11755713 (intergenic)] II. or1985 is a CRISPR/Cas9 engineered deletion of zyg-9 removing the entire open reading frame. Heterozygotes are wild-type and GFP+ and segregate WT GFP+ (hets), or1948 homozygotes (GFP-, lay 100% dead embryos) and paralysed DpyUnc GFP+ (mnC1 homozygotes). Maintain by picking WT GFP+. Reference: Harvey AM, et al. PLoS Genet. 2023 Jan 6;19(1):e1010363. doi: 10.1371/journal.pgen.1010363. PMID: 36608115
|
|
HBR2340 |
C elegans |
flp-11(syb1445[flp-11::SL2::unc-58(L428F)::linker::mKate2]) X. Show Description
unc-58(L428F) was knocked into the endogenous locus of flp-11 to express a sodium channel in RIS that causes strong overactivation of RIS. Reference: Busack I & Bringmann H. PLOS Genetics 19(3): e1010665. https://doi.org/10.1371/journal.pgen.1010665.
|
|
HY123 |
C. elegans |
nhr-31(ye123) IV. Show Description
Maintain at 15C. Temperature-sensitive: slow growth rate, reduced brood size. Resistant to Cry proteins. Isolated from EMS screen in N2 background. Reference: Kim YM, et al. PLoS Pathog. 2024 Oct 18;20(10):e1012611. doi: 10.1371/journal.ppat.1012611. PMID: 39423230.
|
|
IZ1458 |
C. elegans |
ufIs126 V. Show Description
ufIs126 [flp-13p::acr-12::GFP + lgc-11::mCherry] V. ACR-12::GFP expression labels postsynaptic iAChRs in DD motor neurons. References: Philbrook A, et al. eLife. 2018 Jul 24;7:e35692. doi: 10.7554/eLife.35692. PMID: 30039797. Oliver D, et al. PLoS Genet. 2022 Jan 28;18(1):e1010016. doi: 10.1371/journal.pgen.1010016. PMID: 35089924. Alexander K, et al. bioRxiv 2022.10.21.512874; doi: https://doi.org/10.1101/2022.10.21.512874.
|
|
JEL1162 |
C. elegans |
brd-1(xoe18) III. Show Description
Weak Emb and Him. N2 parental background. Reference: Li Q, et al. PLoS Genet. 2023 Jan 30;19(1):e1010457. doi: 10.1371/journal.pgen.1010457. PMID: 36716349.
|
|
JEL730 |
C. elegans |
brc-1(xoe4) III. Show Description
Weak Emb and Him. Reference: Li Q, et al. PLoS Genet. 2023 Jan 30;19(1):e1010457. doi: 10.1371/journal.pgen.1010457. PMID: 36716349.
|
|
LE1012 |
C. elegans |
ced-10(tm597)/dpy-13(e184) IV. Show Description
Heterozygotes are semi-Dpy and throw semi-Dpy, Dpy, and WT (which throw all dead eggs).
|
|
MT3773 |
C. elegans |
unc-42(e270) vab-8(e1017) V. Show Description
Unc. Posterior half thin and pale.
|
|
OH17767 |
C. elegans |
ins-6(syb5463[ins-6::SL2::GFP::H2B]) II; otIs669 him-5(e1490) V. Show Description
CRISPR/Cas9 engineered tagged endogenous locus. Him. See description of strain OH15262 for full description of otIs669 NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene (Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642). Reference: Reilly MB, et al. PLoS Genet. 2022 Sep 30;18(9):e1010372. doi: 10.1371/journal.pgen.1010372. PMID: 36178933.
|
|
PHX1433 |
C elegans |
flp-11(syb1433[flp-11::SL2::egl-23(cDNA)(A383V)::linker::mKate2]) X. Show Description
egl-23 cDNA(A383V) was knocked into the endogenous locus of flp-11 to express a potassium channel in RIS that causes moderate inactivation of RIS. Reference: Busack I & Bringmann H. PLOS Genetics 19(3): e1010665. https://doi.org/10.1371/journal.pgen.1010665.
|
|
PHX1464 |
C elegans |
flp-11(syb1464[flp-11::SL2::egl-23(cDNA)(L229N)::linker::mKate2]) X. Show Description
egl-23 cDNA(L229N) was knocked into the endogenous locus of flp-11 to express a potassium channel in RIS that causes strong inactivation of RIS. Reference: Busack I & Bringmann H. PLOS Genetics 19(3): e1010665. https://doi.org/10.1371/journal.pgen.1010665.
|
|
PHX2193 |
C elegans |
flp-11(syb2193[flp-11::SL2::mKate2::linker::twk-18(e1913)]) X. Show Description
twk-18(e1913) was knocked into the endogenous locus of flp-11 to express a potassium channel in RIS that causes very strong inactivation of RIS. Reference: Busack I & Bringmann H. PLOS Genetics 19(3): e1010665. https://doi.org/10.1371/journal.pgen.1010665.
|
|
PHX2493 |
C elegans |
lgc-38(syb2346[flp-11p::dpy-10 site::flp-11 3UTR] syb2493[ReaChR::linker::mKate2]) III. Show Description
ReaChR expressed in RIS for optogenetic activation. Reference: Busack I & Bringmann H. PLOS Genetics 19(3): e1010665. https://doi.org/10.1371/journal.pgen.1010665.
|
|
PHX2605 |
C. elegans |
ceh-13(syb2605[ceh-13::GFP]) III. Show Description
GFP tag inserted at the C-terminus of the endogenous ceh-13 locus by CRISPR. Reference: Murray JI, et al. PLOS Genet. 2022 May 2;18(5):e1010187. PMID: 35500030
|
|
PHX2679 |
C. elegans |
nob-1(syb2679[nob-1::GFP]) III. Show Description
GFP tag inserted at the C-terminus of the endogenous nob-1 locus by CRISPR. Reference: Murray JI, et al. PLOS Genet. 2022 May 2;18(5):e1010187. PMID: 35500030
|
|
PHX3190 |
C elegans |
lgc-38(syb2346[flp-11p::dpy-10 site::flp-11 3UTR] syb3190[unc-58(e665)::linker(GSGSGSGSG)::mKate2]) III. Show Description
flp-11p::unc-58(e665) was knocked into a SKI LODGE site to express a sodium channel in RIS that causes moderate over activation of RIS. Reference: Busack I & Bringmann H. PLOS Genetics 19(3): e1010665. https://doi.org/10.1371/journal.pgen.1010665.
|
|
PHX3685 |
C. elegans |
dpy-17(syb3685[dpy-17::mNG]) III. Show Description
mNeonGreen tag inserted at C-terminus of endogenous dpy-17 locus. GGATACAGAAACTAA -> GGATACAGAAAC^TAA. Reference: Birnbaum SK, et al. PLoS Genet. 2023 Sep 18;19(9):e1010944. doi: 10.1371/journal.pgen.1010944. PMID: 37721936.
|
|
PHX3691 |
C. elegans |
sqt-3(syb3691[sqt-3::mNG(int)]) V. Show Description
mNeonGreen tag inserted into endogenous sqt-3 locus between CFCS and collagen domains. GCCTACGGAGGACCAGAAGTCAACC -> GCCTACGGAGGA^CCAGAAGTCAACC. Reference: Birnbaum SK, et al. PLoS Genet. 2023 Sep 18;19(9):e1010944. doi: 10.1371/journal.pgen.1010944. PMID: 37721936.
|
|