NK2730 |
C. elegans |
rpl-4(qy128[rpl-4::gfp11]) bmdSi15 I. Show Description
bmdSi15 [loxN + eef-1A.1p::GFP(1-10)::unc-54 3? UTR + let-858 terminator + myo-2p::mCherry::3xHA::tbb-2 3? UTR + loxP] I. bmdSi15 is a CRISPR-based integration into the ttTi4348 site (I:-5.32). Split GFP tag (GFP11) inserted into the C-terminus of the endogenous rpl-41 locus.
|
|
TY1077 |
C. elegans |
C25D7.12(y128) unc-76(e911)/sdc-3(y52) unc-76(e911) V; xol-1(y9) X. Show Description
Heterozygotes are Unc and segregate Uncs, Dpy Uncs [C25D7.12(y128) unc-76(e911) homozygotes], and Tra Uncs [sdc-3(y52) unc-76(e911) homozygotes]. Do not distribute this strain; other labs should request it directly from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
TY1388 |
C. elegans |
C25D7.12(y128)/sdc-3(y52) unc-76(e911) V. Show Description
Heterozygotes are WT and segregate WT, Dpys [C25D7.12(y128) homozygotes], and Tra Uncs [sdc-3(y52) unc-76(e911) homozygotes]. Do not distribute this strain; other labs should request it directly from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
PS8365 |
C. elegans |
oac-8(sy1284) IV. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of oac-8;
Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette).
Left flanking sequence: CTCGCGTTTCACTTTTTCCCTAAAACCTTCCCAAAT
Right flanking sequence: GGGTATATTGGAGTAGATATgtaggttgaaataaa
inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : TCTACTCCAATATACCCATT
Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
|
|
PS8367 |
C. elegans |
oac-22(sy1286) IV. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of oac-22;
Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette).
Left flanking sequence: CACGCGTTACTTTTTGTGTCAAACAGACCAAAAA
Right flanking sequence: CTGTGGCAGAGGACTATTTTACAATGgtaggtgctg
inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : GTCAAACAGACCAAAAACTG
Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
|
|
PS8369 |
C. elegans |
oac-34(sy1288) I. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of oac-34;
Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette).
Left flanking sequence: gCTTCTTTGTGATCTCCGGTTACCTGATGGCCCGTA.
Right flanking sequence: ACCTGACACACATGAAAATCTCCAAAATCAGTGAC
inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : TTTCATGTGTGTCAGGTTAC
Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
|
|
PY1283 |
C. elegans |
ttx-1(oy29) oyIs17 V. Show Description
oyIs17 [gcy-8p::GFP + lin-15(+)] V. Thermotaxis defective. Reduced gcy-8::GFP expression in AFD at 25C.
|
|
TV26950 |
C. elegans |
dma-1(wy1286[dma-1::tagRFP]) I; rab-7(wy1390) II; wyIs910 X. Show Description
wyIs910 [ser-2(prom3)::FLP + unc-122p::BFP] X. tagRFP tag inserted into endogenous dma-1 locusafter the DMA-1 transmembrane domain and before cytoplasmic tail. rab-7(wy1390) = endogenous GFP-FLPon-RAB-7. Reference: Eichel K, et al. Nature. 2022 Sep;609(7925):128-135. PMID: 35978188.
|
|
TV26971 |
C. elegans |
rab-11.1(wy1389[GFP::FLP::rab-11.1]) dma-1(wy1286[dma-1::tagRFP]) I; wyIs910 X. Show Description
wyIs910 [ser-2(prom3)::FLP + unc-122p::BFP] X. tagRFP tag inserted into endogenous dma-1 locus after the DMA-1 transmembrane domain and before cytoplasmic tail. GFP::FLP tag inserted into endogenous rab-11.1 locus. Reference: Eichel K, et al. Nature. 2022 Sep;609(7925):128-135. PMID: 35978188.
|
|