More Fields
Strain Species Genotype
TY1077 C. elegans C25D7.12(y128) unc-76(e911)/sdc-3(y52) unc-76(e911) V; xol-1(y9) X. Show Description
Heterozygotes are Unc and segregate Uncs, Dpy Uncs [C25D7.12(y128) unc-76(e911) homozygotes], and Tra Uncs [sdc-3(y52) unc-76(e911) homozygotes]. Do not distribute this strain; other labs should request it directly from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
TY1388 C. elegans C25D7.12(y128)/sdc-3(y52) unc-76(e911) V. Show Description
Heterozygotes are WT and segregate WT, Dpys [C25D7.12(y128) homozygotes], and Tra Uncs [sdc-3(y52) unc-76(e911) homozygotes]. Do not distribute this strain; other labs should request it directly from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
PS8365 C. elegans oac-8(sy1284) IV. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of oac-8; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CTCGCGTTTCACTTTTTCCCTAAAACCTTCCCAAAT Right flanking sequence: GGGTATATTGGAGTAGATATgtaggttgaaataaa inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : TCTACTCCAATATACCCATT Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS8367 C. elegans oac-22(sy1286) IV. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of oac-22; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CACGCGTTACTTTTTGTGTCAAACAGACCAAAAA Right flanking sequence: CTGTGGCAGAGGACTATTTTACAATGgtaggtgctg inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : GTCAAACAGACCAAAAACTG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS8369 C. elegans oac-34(sy1288) I. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of oac-34; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: gCTTCTTTGTGATCTCCGGTTACCTGATGGCCCGTA. Right flanking sequence: ACCTGACACACATGAAAATCTCCAAAATCAGTGAC inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : TTTCATGTGTGTCAGGTTAC Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PY1283 C. elegans ttx-1(oy29) oyIs17 V. Show Description
oyIs17 [gcy-8p::GFP + lin-15(+)] V. Thermotaxis defective. Reduced gcy-8::GFP expression in AFD at 25C.