Strain Information
Name | UDN100163 View On Wormbase |
---|---|
Species | C. elegans |
Genotype | pph-5(udn93) V. |
Description | pph-5 [A48A] #1 control edit for strain UDN100160 from Fielder, et al. (2022). Wild-type sequence except for addition of silent AvaII restriction site and silent PAM ablation. Homozygous viable and wild-type appearance. Genotype using primers Forward: accggaaattgtcccaaaat, Reverse: tttccgactttctggaggtg. Digest with AvaII restriction enzyme for resulting sizes of 401bp +403bp. Wild-type product will not be digested. |
Mutagen | Crispr/Cas9 |
Outcrossed | x2 |
Made by | UDN Screening Center |
Laboratory | UDN |
Reference | Fielder et al, 2022. Mol Genet Metab, In Press |
Sign in
or
register an account if you want to order this strain.