Strain Information
| Name | UDN100163 View On Wormbase |
|---|---|
| Species | C. elegans |
| Genotype | pph-5(udn93) V. |
| Description | pph-5 [A48A] #1 control edit for strain UDN100160 from Fielder, et al. (2022). Wild-type sequence except for addition of silent AvaII restriction site and silent PAM ablation. Homozygous viable and wild-type appearance. Genotype using primers Forward: accggaaattgtcccaaaat, Reverse: tttccgactttctggaggtg. Digest with AvaII restriction enzyme for resulting sizes of 401bp +403bp. Wild-type product will not be digested. |
| Mutagen | Crispr/Cas9 |
| Outcrossed | x2 |
| Made by | UDN Screening Center |
| Laboratory | UDN |
| Reference | Fielder et al, 2022. Mol Genet Metab, In Press |
Sign in
or
register an account if you want to order this strain.