| CHS1038 |
C. elegans |
srt-1(yum1306) srt-2(yum1307) srt-3(yum1308) srt-4(yum1309) srt-5(yum1310) srt-6(yum1298) srt-7(yum1299) srt-8(yum1300) V; srt-11(yum1301) II; srt-12(yum1302) srt-13(yum1303) srt-14(yum1304) V. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
|
|
| CHS1040 |
C. elegans |
nmur-1(yum1317) X; nmur-2(yum1318) II; nmur-3(yum1319) X; nmur-4(yum1320) I. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
|
|
| CHS1041 |
C. elegans |
frpr-3(yum1321) V; frpr-4(yum1322) frpr-16(yum1323) II; frpr-18(yum1324) V. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
|
|
| CHS1056 |
C. elegans |
sre-1(yum1398) sre-2(yum1399) sre-3(yum1400) II; sre-4(yum1401) sre-5(yum1402) IV; sre-6(yum1403) V. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
|
|
| CHS1061 |
C. elegans |
tkr-1(yum1419) III; tkr-2(yum1420) tkr-3(yum1421) IV. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
|
|
| CHS1073 |
C. elegans |
srt-1(yum1464) srt-2(yum1465) srt-3(yum1466) V. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
|
|
| CHS1082 |
C. elegans |
sprr-3(yum1504) IV; sprr-1(yum1502) sprr-2(yum1503) X. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
|
|
| CHS1087 |
C. elegans |
ser-3(yum1518) I; ser-6(yum1519) IV; octr-1(yum1517) X. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
|
|
| CHS1088 |
C. elegans |
tyra-3(yum1522) tyra-2(yum1521) ser-2(yum1520) X. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
|
|
| CHS1096 |
C. elegans |
srg-69(yum1553) II; srg-3(yum1554) srg-4(yum1555) III; srg-38(yum1550) srg-54(yum1551) srg-55(yum1552) V. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
|
|
| CHS1116 |
C. elegans |
srr-1(yum1685) srr-2(yum1686) srr-3(yum1687) srr-4(yum1688) srr-6(yum1689) V. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
|
|
| CHS1126 |
C. elegans |
dmsr-1(yum1734) V; dmsr-2(yum1735) I; dmsr-3(yum1736) II; dmsr-8(yum1737) V. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
|
|
| CHS1131 |
C. elegans |
egl-47(yum1765) V; lite-1(yum1763) gur-3(yum1764) X. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
|
|
| CHS1135 |
C. elegans |
srx-1(yum1785) srx-2(yum1786) srx-3(yum1787) srx-4(yum1788) V. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
|
|
| CHS1145 |
C. elegans |
srab-1(yum1849) srab-2(yum1850) srab-3(yum1851) srab-4(yum1852) srab-13(yum1853) srab-23(yum1854) V; k08b5.1(yum1856) X; y41d4b.1(yum1855) IV. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
|
|
| CHS1149 |
C. elegans |
srh-1(yum1874) srh-2(yum1875) srh-3(yum1876) srh-4(yum1877) srh-5(yum1878) srh-7(yum1879) srh-8(yum1880) V. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
|
|
| CHS1157 |
C. elegans |
npr-1(yum1928) npr-2(yum1929) npr-3(yum1930) npr-4(yum1931) npr-5(yum1932) npr-10(yum1933) X. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
|
|
| CHS1178 |
C. elegans |
aex-2(yum2061) aexr-1(yum2062) aexr-2(yum2063) aexr-3(yum2064) X. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
|
|
| CHS1182 |
C. elegans |
str-196(yum2084) str-198(yum2085) str-199(yum2086) str-200(yum2087) str-204(yum2088) str-205(yum2089) str-193(yum2090) str-2(yum2091) str-3(yum2092) V. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
|
|
| CHS1188 |
C. elegans |
srw-1(yum2124) srw-2(yum2125) srw-3(yum2126) srw-4(yum2127) srw-6(yum2128) srw-7(yum2129) srw-8(yum2130) V. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
|
|
| CHS1190 |
C. elegans |
srd-1(yum2136) srd-2(yum2137) srd-3(yum2138) srd-4(yum2139) srd-5(yum2140) srd-7(yum2141) srd-8(yum2142) srd-9(yum2143) II. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
|
|
| CHS1198 |
C. elegans |
srv-1(yum2185) srv-2(yum2186) srv-3(yum2187) srv-4(yum2188) srv-17(yum2189) srv-19(yum2190) srv-21(yum2191) srv-22(yum2192) srv-34(yum2193) III. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
|
|
| CHS1210 |
C. elegans |
srsx-1(yum2261) srsx-2(yum2262) srsx-3(yum2263) srsx-5(yum2264) srsx-6(yum2265) srsx-7(yum2266) V. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
|
|
| CHS1212 |
C. elegans |
gnrr-1(yum2273) gnrr-2(yum2274) gnrr-3(yum2275) gnrr-4(yum2276) gnrr-5(yum2277) gnrr-6(yum2278) gnrr-7(yum2279) I. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
|
|
| CHS1220 |
C. elegans |
srm-1(yum2328) srm-2(yum2329) srm-3(yum2330) srm-4(yum2331) srm-5(yum2332) srm-6(yum2333) srn-1(yum2334) IV. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
|
|
| CHS1229 |
C. elegans |
sru-1(yum2381) sru-2(yum2382) sru-3(yum2383) sru-4(yum2384) sru-6(yum2385) sru-8(yum2386) IV. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
|
|
| CHS1234 |
C. elegans |
sra-2(yum2416) sra-3(yum2417) sra-4(yum2418) sra-6(yum2419) sra-7(yum2420) sra-8(yum2421) sra-9(yum2422) II. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
|
|
| CHS1250 |
C. elegans |
srz-1(yum2552) V; srz-3(yum2553) srz-4(yum2554) I; srz-5(yum2555) srz-6(yum2556) II; srz-8(yum2557) srz-9(yum2558) III. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
|
|
| CHS1256 |
C. elegans |
dop-1(yum2598) dop-2(yum2599) dop-3(yum2600) dop-4(yum2601) dop-5(yum2602) c24a8.6(yum2603) dop-6(yum2604) ser-6(yum2605) X. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
|
|
| CHS1265 |
C. elegans |
str-3(yum1042) str-4(yum2669) str-5(yum2670) str-1(yum2671) str-6(yum2672) str-7(yum2673) str-9(yum2674) c04c3.7(yum2675) str-8(yum2676) t23d5.8(yum2677) IV. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
|
|
| CHS1269 |
C. elegans |
srb-1(yum2701) srb-2(yum2702) srb-3(yum2703) srb-5(yum2704) srb-12(yum2705) srb-13(yum2706) II. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
|
|
| CHS1272 |
C. elegans |
srbc-1(yum2739) srbc-2(yum2740) srbc-3(yum2741) srbc-5(yum2742) srbc-6(yum2743) srbc-7(yum2744) srbc-8(yum2745) srbc-9(yum2746) srbc-10(yum2747) srbc-11(yum2748) V. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
|
|
| CHS1275 |
C. elegans |
mgl-1(yum2769) mgl-2(yum2770) mgl-3(yum2771) c30a5.10(yum2772) f35h10.10(yum2773) X. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
|
|
| CL2621 |
C. elegans |
smg-1(cc546) I; dvIs75. Show Description
dvIs75 [myo-3::Abeta 1-42 G37L::3' UTR(long) + mtl-2::GFP)]. Temperature-inducible induction of human Abeta peptide in body wall muscle; paralysis in ~32 hr if induced as L3 larvae. Maintain at 16 C to prevent strong Abeta induction and larval paralysis/arrest. Reference: Fonte V., et al. Mol Neurodegener. 2011 Aug 23;6(1):61. [NOTE: The temperature-sensitive allele cc546 causes an M1957L change in SMG-1. The lesion is an atg>ttg transversion in exon 35. Flanking sequences follow with the mutation site indicated with a capital A: ttggtggtcggttacaaaacgatattcaaga tcactggcagtcatgagtAtggttggatcagttttaggactcggtgatcg acatttggacaatttattg The lesion is detectable via SNP-snip with the mutation causing loss of an MslI site. Primers are for a 323 bp product. Digest with MslI to 86+237 in the wild type, uncut as 323 in the mutant. DJR701(f): CAGTCGTGAGCTTTGGATGCGTGC DJR702(r): TCGGGGATACGCAGATTCTTTCCC. Pedone ... Reiner G3 (2021).]
|
|
| CL2659 |
C. elegans |
smg-1(cc546) I; dvIs770. Show Description
dvIs770 [myo-3::Abeta 1-42 wt::3' UTR(long) + mtl-2::GFP]. Maintain at 16 C to prevent strong Abeta induction and larval paralysis/arrest. Temperature-inducible induction of human Abeta peptide in body wall muscle; paralysis in 18-24 hr if induced as L3 larvae. NOTE: dvIs770 was originally described as dvIs70 in Fonte et al, 2011. The name of this array was changed to dvIs770 to avoid confusion with dvIs70 [hsp-16.2p::GFP + rol-6(su1006)] carried in strain CL2070. Reference: Fonte V., et al. Mol Neurodegener. 2011 Aug 23;6(1):61. [NOTE: The temperature-sensitive allele cc546 causes an M1957L change in SMG-1. The lesion is an atg>ttg transversion in exon 35. Flanking sequences follow with the mutation site indicated with a capital A: ttggtggtcggttacaaaacgatattcaaga tcactggcagtcatgagtAtggttggatcagttttaggactcggtgatcg acatttggacaatttattg The lesion is detectable via SNP-snip with the mutation causing loss of an MslI site. Primers are for a 323 bp product. Digest with MslI to 86+237 in the wild type, uncut as 323 in the mutant. DJR701(f): CAGTCGTGAGCTTTGGATGCGTGC DJR702(r): TCGGGGATACGCAGATTCTTTCCC. Pedone ... Reiner G3 (2021).]
|
|
| CLP546 |
C. elegans |
twnEx185. Show Description
twnEx185 [mec-7p::MTS::roGFP + mec-7p::TOMM20::mCherry + ttx-3p::GFP]. Pick animals with GFP expression in head neurons (AIY) to maintain. roGFP can be used to monitor redox status of the mitochondrial matrix in the six touch receptor neurons: the oxidation-reduction status of mitochondrial matrix can be monitored with roGFP, a GFP variant that increases brightness in a more oxidized environment. The mitochondrial outer membrane in these neurons are marked by mCherry. Reference: Jiang HC, et al. Proc Natl Acad Sci USA. 2015 Jul 14;112(28):8768-73. doi: 10.1073/pnas.1501831112. PMID: 26124107. [NOTE: twnEx185 is incorrectly described as carrying myo-2p::GFP in the reference publication. The correct co-injection marker is ttx-3::GFP.]
|
|
| COP2343 |
C. elegans |
spin-3(knu1020[spin-3::mCherry::loxP::HygR::loxP]) X. Show Description
mCherry tag inserted at the C-terminus of the endogenous spin-3 locus via CRISPR/Cas9 engineering. This strain may not be distributed to commercial or for-profit entities without prior written permission from In Vivo Biosystems. Please contact support@invivobiosystems.com for more information. Reference: Villalobos TV, et al. Nat Aging. 2023 Sep;3(9):1091-1106. PMID: 37580394.
|
|
| CP157 |
C. remanei |
nmDf1 III. Show Description
nmDf1 removes all four tandem paralogs of the mss family (Cre-mss-1, Cre-mss-2, Cre-mss-3, and Cre-mss-4). Male sperm is less competitive than wild-type male sperm, and females have lower brood size due to inbreeding depression. Reference: Yin D, et al. Science. 2018 Jan 5;359(6371):55-61.
|
|
| CP174 |
C. briggsae |
nmIs11. Show Description
nmIs11 [Cbr-msrp-3(+) + Cbr-unc-119(+) + myo-2::GFP]. GFP expression in pharynx. Wild-type (non-Unc) movement. Roughly two-fold over-expression of Cbr-msrp-3(+); has no measurable effect on fertility. Cbr-MSRP-3 is a sperm surface glycoprotein with homologs in C. elegans and other species. Reference: Van Goor J, et al. Curr Biol. 2025 35:1-7.
|
|
| CP175 |
C. briggsae |
nmIs12. Show Description
nmIs12 [Cbr-msrp-3(+) + Cbr-unc-119(+) + myo-2::GFP]. GFP expression in pharynx. Wild-type (non-Unc) movement. Roughly two-fold over-expression of Cbr-msrp-3(+); has no measurable effect on fertility. Cbr-MSRP-3 is a sperm surface glycoprotein with homologs in C. elegans and other species. Reference: Van Goor J, et al. Curr Biol. 2025 35:1-7.
|
|
| CP196 |
C. briggsae |
Cbr-msrp-3(nm85) I; mfIs29. Show Description
mfIs29 [Cel-lip-1::GFP + Cel-myo-2::GFP]. Strong GFP expression in pharynx and weak GFP expression in various somatic and germline tissues. nm85 is a likely null frameshift mutation in the sperm-expressed Cbr-msrp-3, but has no apparent reproductive phenotypes. To confirm presence of nm85 mutation, use primers AT19+AT20 (WT: 291 nt, nm85: 286 nt). AT19: AAGAAGAGAGAAACCAGAAGC. AT20: AAAAGTAAAACATACCGATCACA. Reference: Van Goor J, et al. Curr Biol. 2025 35:1-7.
|
|
| CP198 |
C. briggsae |
Cbr-msrp-3(nm77[HA::Cbr-msrp-3]) I. Show Description
nm77 is an HA epitope tag inserted into the endogenous Cbr-msrp-3 locus, two codons after the predicted signal peptide cleavage site of Cbr-MSRP-3. Anti-HA antibodies recognize the tagged Cbr-MSRP-3 glycoprotein on immunoblots, in the membranous organelles of spermatids, and on the plasma membrane of activated sperm (including pseudopod) in both males and hermaphrodites. To confirm presence of the nm77 insertion, use primers AT19+AT20 (WT: 291 nt, nm77: 318 nt). AT19: AAGAAGAGAGAAACCAGAAGC. AT20: AAAAGTAAAACATACCGATCACA. Reference: Van Goor J, et al. Curr Biol. 2025 35:1-7.
|
|
| CP201 |
C. briggsae |
nmDf3 I; mfIs29. Show Description
mfIs29 [Cel-lip-1::GFP + Cel-myo-2::GFP]. Strong GFP expression in pharynx and weak GFP expression in various somatic and germline tissues. nmDf3 is an 8411 bp deletion that removes Cbr-msrp-2, Cbr-msrp-3, Cbr-msrp-4, Cbr-msrp-6, and Cbr-msrp-6, but has no apparent reproductive phenotypes. [NOTE: Van Goor J, et al. (2005) incorrectly described the nmDf3 as a 5807 bp deletion.] To confirm presence of deletion, use primers AT72+AT73 (WT: 11213 nt, nmDf3: 2802) and AT20+AT75 (WT: 855 nt, nmDf3: no product). AT72: GTACGACGGATAGAGTGTGAT. AT73: CTGTGGGATTATGAAAAGACTC. AT20: AAAAGTAAAACATACCGATCACA. AT75: CAGCAGCAACCTTAGAACAT. Reference: Van Goor J, et al. Curr Biol. 2025 35:1-7.
|
|
| CP217 |
C. briggsae |
Cbr-msrp-1(nm86) nmDf3 I; mfIs29. Show Description
mfIs29 [Cel-lip-1::GFP + Cel-myo-2::GFP]. Strong GFP expression in pharynx and weak GFP expression in various somatic and germline tissues. nmDf3 is an 8411 bp deletion that removes Cbr-msrp-2, Cbr-msrp-3, Cbr-msrp-4, Cbr-msrp-6, and Cbr-msrp-6. Removal of all six Cbr-msrp paralogs has no apparent reproductive phenotypes. [NOTE: Van Goor J, et al. (2005) incorrectly described the nmDf3 as a 5807 bp deletion.] To confirm presence of nm86 mutation, use primers AT130+AT131 (WT: 184 nt, nm86: 224 nt).
AT130: CGAAATAATTGAACCTACCAAGA.
AT131: CACTCTCTCTGACTGCAAACG. To confirm presence of deletion, use primers AT72+AT73 (WT: 11213 nt, nmDf3: 2802) and AT20+AT75 (WT: 855 nt, nmDf3: no product). AT72: GTACGACGGATAGAGTGTGAT. AT73: CTGTGGGATTATGAAAAGACTC. AT20: AAAAGTAAAACATACCGATCACA. AT75: CAGCAGCAACCTTAGAACAT. Reference: Van Goor J, et al. Curr Biol. 2025 35:1-7.
|
|
| CP87 |
C. briggsae |
Cbr-fem-3(nm63) IV. Show Description
XO are self-fertile hermaphrodites with low brood size and some somatic gonad defects. XX animals have normal brood size.
|
|
| CP89 |
C. briggsae |
Cbr-fem-2(nm27) III; Cbr-fem-3(nm63) IV. Show Description
XX are self-fertile hermaphrodites.
|
|
| CS119 |
C. elegans |
sma-3(wk30) III; him-5(e1490) V; qcEx24. Show Description
qcEx24 [GFP::sma-3 + rol-6(su1006)]. Rollers. Pick rollers to maintain. Array rescues body size phenotype. Reference: Wang J, Tokarz R, Savage-Dunn C. Development. 2002 Nov;129(21):4989-98.
|
|
| CS210 |
C. elegans |
sma-3(wk30) III; him-5(e1490) V; qcEx52. Show Description
qcEx52 [myo-2p::GFP::sma-3 + rol-6(su1006)]. Sma. Rollers. Pick rollers to maintain. Reference: Wang J, Tokarz R, Savage-Dunn C. Development. 2002 Nov;129(21):4989-98.
|
|
| CS211 |
C. elegans |
sma-3(wk30) III; him-5(e1490) V; qcEx53. Show Description
qcEx53 [vha-6p::GFP::sma-3 + rol-6(su1006)]. Sma. Rollers. Pick rollers to maintain. Reference: Wang J, Tokarz R, Savage-Dunn C. Development. 2002 Nov;129(21):4989-98.
|
|
| CS619 |
C. elegans |
sma-3(wk30) III; qcIs59. Show Description
qcIs59 [vha-6p::GFP::sma-3 + rol-6(su1006)]. Small Rollers. GFP::SMA-3 fusion protein is expressed in the intestine. Derivative of a strain described in Wang et al., 2002, Development 129:4989-4998.
|
|