Search Strains

Him. Temperature-sensitive: infertile above 20C. Variably masculinized XX hermaphrodites segregating normal XO males. Stronger XX masculinization than null alleles of tra-3. Reference: Francis et al. (1995) PMID: 7713420.

Temperature-sensitive. Maintain at 15C. Gonad development abnormal, sterile at 25C, variably fertile at 15C. Reference: Hodgkin (unpublished).

Maintain by crossing males and hermaphrodites; may revert to purely hermaphrodite line. Fertile hermaphrodites and fertile males. Obligate XX strain with sex determined by her-1 V. Reference: Strain 9 in Hodgkin (2002) PMID: 12399387.

Resistant to infection by Microbacterium nematophilum (no tail swelling).

Male/hermaphrodite strain, propagate by crossing. Fertile XX hermaphrodites and fertile XX males. Obligate XX strain with sex determined by amber-suppressing tRNA, sup-34. Reference: Strain 14 in Hodgkin (2002) PMID: 12399387.

Dumpy (partially-suppressed Dpy-31). Sqt-3 mediated suppression of dpy-31 lethality. Reference: Novelli et al. (2004) PMID: 15579684.

Slightly dumpy. Variable cold-sensitive lethal (poor viability at 15C). Unusual missense allele (D297G) of sqt-3, suppresses dpy-31 lethality. Reference: Novelli et al. (2006) PMID: 16452136.

Homozygous viable dpy. dpy-31(e2919) homozygotes are almost inviable, but lethality is efficiently suppressed by sqt-3(e2906). Reference: Novelli J, et al., Genetics. 2004 Nov;168(3):1259-73.

Squat, dumpy at 15C. Inviable at higher temperatures. Deletion of most of sqt-3 coding sequence. Null by antibody staining.

Weak dumpy. Variable tail abnormal at 20C or higher. Cold-sensitive: most arrest as pretzel-stage embryos, with some escapers arresting as severely distorted L1 larvae at 15. Unusual missense allele (K280E) of sqt-3, cold-sensitive lethal and suppressor of dpy-31 lethality. Reference: Novelli et al. (2006) PMID: 16452136.

Notched head. Recessive. 100% Penetrance. Male spicules abnormal. M-MATING-NO SUCCESS. See also WBPaper00002236.

Surface abnormal. Resistant to infection by Microbacterium nematophilum (no tail swelling). Nonsense mutation Q89stop(UAA).

eEx650 [ilys-3p::GFP + unc-119(+)]. Pick wild-type to maintain. Transcriptional reporter transgene for ilys-3. Reference: Gravato-Nobre et al. (2016) PMID: 27525822.

Hypersensitive to drugs. Resistant to infection by M. nematophilum and Leucobacter Verde2. Hypersensitive to Leucobacter Verde1. Reference: O'Rourke et al. (in preparation).

Viable, but defective in bacterial grinding and hypersensitive to bacterial pathogens. Derived by out-crossing parental strain VC2496. Reference: Gravato-Nobre et al. (2016) PMID: 27525822.

eEx752 [ilys-3p::ilys-3::mCherry::unc-54 3'UTR + unc-119(+)]. Pick wild-type (non-Unc) to maintain. Rescuing translational reporter for ilys-3. Reference: Gravato-Nobre et al. (2016) PMID: 27525822.

eEx754 [ilys-3p::ilys-3::mCherry::unc-54 3'UTR + sur-5p::GFP]. Pick GFP+ to maintain. Translational reporter for ilys-3. Reference: Gravato-Nobre et al. (2016) PMID: 27525822.

Viable, poor bacterial grinding, increased sensitivity to bacterial pathogens. Reference: Gravato-Nobre et al. (2016) PMID: 27525822.

Viable, but with poor bacterial grinding and increased susceptibility to some bacterial pathogens. Reference: Gravato-Nobre et al. (2016) PMID: 27525822.

Bah (resistant to Yersinia biofilm formation). Reference: Hodgkin et al (in preparation).

eEx730 [ptr-15(+) + sur-5p::GFP]. Pick GFP+ to maintain. Lon. Non-GFP animals will mostly be dead eggs and dead hatchlings, but can segregate rare GFP-negative viable ptr-15 lon-3 homozygotes (which are fertile but grow very poorly). Reference: Kuwabara et al. (in prep.)

Left hand Roller. Incomplete penetrance. M-MATING+POOR <1%WT.

Blistered cuticle. Bursae abnormal. Dpy. Males abnormal. M-MATING-NO SUCCESS.

Acetylcholine abnormal. Unc (phenotype exactly like unc-52 except lacking class C acetylcholinesterase).

Unc and Egl.

Gla. May contain dam-1(op241) in background. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

ep369 is a weak allele. ep6 is a deletion allele. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

Heterozygotes are WT, GFP+ in the pharynx and segregate WT (GFP+ in the pharynx), dead eggs (homozygotes for hT2) and ham-3(he159) homozygotes, which are Sma, Egl, Adl, Pvl. Maintain by picking GFP+ worms and checking for correct segregation, since the hT2 balancer is lost at low frequencies. he159 allele was isolated by John Satterlee from a deletion library at Sander van den Heuvel's lab. Reference: Ertl I, et al. Genetics. 2016 Mar;202(3):961-75.

Maintain at 15C. Temperature sensitive. Reduced brood size, Sma. Reference: Cornes E, et al. RNA. 2015 Sep;21(9):1544-53.

Abnormal locomotion can be rescued with dopamine. cat-2(cer181) is a complete deletion of the cat-2 gene (coding sequence + introns), which was substituted by the sequence of the step 1 repair for GFP::H2B (Nested CRISPR, Vicencio et al, Genetics 2019). Allele can be detected using the following primers: Fwd: ctatgtgaagtcacacctgtc Rev: cttgctggaagtgtacttggtg. Reference: Martínez-Fernández C, et al. Dis Model Mech. 2022 Mar 1;15(3):dmm049161. doi: 10.1242/dmm.049161. PMID: 35107130

muIs32 [mec-7p::GFP + lin-15(+)]. QL descendants migrate anteriorly.

Daf-c at 25.5C; grow at 20C or less. Long lived.

muEx265 [hsf-1p::hsf-1(cDNA) + myo-3::GFP]. Pick GFP worms to maintain.

Long lifespan. Maintain at 15C. Worms develop slowly at 20C, and are sterile at 25C. Reference: Garigan D, et al. Genetics. 2002 Jul;161(3):1101-12.

Daf-c at 25.5C; grow at 20C or less. Long lived.

Quadruple mutant removing four different dopamine receptor genes.

QL descendants anterior, QR descendants slightly posterior to WT. HSN posterior (50%), BDU posterior (50%), DTCs make extra turns. Mild Egl. Male Mating: ME2. mig-14, mom-3, pvl-2, and let-553 are the same gene.

muIs252 [eft-3p::wrmScarlet1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. Somatic expression of wrmScarlet1-10 (under the control of the eft-3 promoter and unc-54 3'UTR). Reference: Goudeau J, et al. Genetics. 2021 Apr 15;217(4):iyab014. doi: 10.1093/genetics/iyab014. PMID: 33693628

muIs253 [eft-3p::sfGFP1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. Somatic expression of sfGFP1-10 (under the control of the eft-3 promoter and the unc-54 3'UTR). [NOTE: A low level of "leaky" GFP expression from sfGFP1-10 is detected at high magnifications.] Reference: Goudeau J, et al. Genetics. 2021 Apr 15;217(4):iyab014. doi: 10.1093/genetics/iyab014. PMID: 33693628

muIs253 [eft-3p::sfGFP1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. muIs252 [eft-3p::wrmScarlet1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. Somatic expression of sfGFP1-10 and wrmScarlet1-10 (both under the control of the eft-3 promoter and the unc-54 3'UTR). [NOTE: A low level of "leaky" GFP expression from sfGFP1-10 is detected at high magnifications.] Reference: Goudeau J, et al. Genetics. 2021 Apr 15;217(4):iyab014. doi: 10.1093/genetics/iyab014. PMID: 33693628

muIs253 [eft-3p::sfGFP1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. Somatic expression of sfGFP1-10 (under the control of the eft-3 promoter and the unc-54 3'UTR). GFP11 tag inserted into endogenous his-3 locus via CRISPR/Cas9 insertion into parental strain CF4587. Reference: Goudeau J, et al. Genetics. 2021 Apr 15;217(4):iyab014. doi: 10.1093/genetics/iyab014. PMID: 33693628

muIs252 [eft-3p::wrmScarlet1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. Homozygous viable. Endogenously-tagged his-3::wrmScarlet11 generated via CRISPR/Cas9 insertion into parental strain CF4582. Reference: Goudeau J, et al. Genetics. 2021 Apr 15;217(4):iyab014. doi: 10.1093/genetics/iyab014. PMID: 33693628

eat-6::wrmScarlet11 split scarlet insertion in the genome with ubiquitous expression of wrmScarlet1-10

muIs252 [eft-3p::wrmScarlet1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. Homozygous viable. Endogenously-tagged his-3::wrmScarlet11(x3) generated via CRISPR/Cas9 insertion of three wrmScarlet11 tags into the endogenous his-3 locus in parental strain CF4582. Reference: Goudeau J, et al. Genetics. 2021 Apr 15;217(4):iyab014. doi: 10.1093/genetics/iyab014. PMID: 33693628

muIs257 [myo-3p::wrmScarlet1-10::unc-54 3'UTR] I. Muscle-specific expression of wrmScarlet1-10 (Under the control of the myo-3 promoter and unc-54 3'UTR). Generated using CRISPR/Cas9 in the SKI-LODGE strain WBM1126. Reference: Goudeau J, et al. bioRxiv 2020.07.02.185249; doi: https://doi.org/10.1101/2020.07.02.185249

muIs252 [eft-3p::wrmScarlet1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. split-wrmScarlet11(MDELYK) inserted at the C-terminus of the endogenous HIS-3 locus; detectable in somatic tissues where wrmScarlet1-10 is present. Figure S6A from Goudeau et al., Genetics 2021. Reference: Goudeau J, et al. Genetics. 2021 Apr; 217(4): iyab014. PMID: 33693628.

eat-6::wrmScarlet11_MDELYK split scarlet insertion in the genome with ubiquitous expression of wrmScarlet1-10

Grow at 15C. Sterile at 25C.

Abnormal V rays (male).