Search Strains

vizSi20 [mex-5p::GFP::gsk-3 (K65A,E77A,D161A,D180A)::tbb-2 3’UTR + unc-119(+)] II. Superficially wild-type. vizSi20 was inserted into Chr II ttTi5605 using MosSci. GSK-3 cDNA was rendered kinase dead by replacing K65, E77, D161 and D180 to alanine. The transgene does not rescue gsk-3 sterility or embryonic lethality defects. Reference: Furuta T, et al. Development. 2018 May 14;145(10). pii: dev161042. doi: 10.1242/dev.161042.

Heterozygotes are Unc and segregate Uncs (heterozygotes), non-Unc mre-11 homozygotes, and dead eggs (nT1 homozygotes). mre-11 homozygotes produce about 200 fertilized eggs but only about 2-3% of these eggs survive to adulthood (this mutation cannot be maintained in a homozygous condition). Occasionally non-Unc progeny that do not demonstrate the mre-11(ok179) mutant phenotype arise when grown in large liquid cultures. mre-11 is the predicted gene ZC302.1

Heterozygotes are WT and GFP+. Segregate syp-3(me42) homozygotes that are non-GFP and lay mostly dead eggs; these mutants form abnormal synaptonemal complex formation during meiosis. Homozygous hT2[bli-4 let-? qIs48] animals are inviable.

Balanced heterozygotes are GFP+ Unc and segregate GFP+ Unc (heterozygotes), non-GFP non-Unc him-3(me80) homozygotes, and dead eggs (nT1 homozygotes). him-3(me80) homozygotes are viable and non-Unc. They produce more than 85% dead eggs and a large fraction (11%) of the survivors are males (Him phenotype). Cytologically they exhibit a reduced level of HIM-3 loading and fewer stretches of SYP-1 than WT. In diakinesis-stage oocytes, they contain a mixture of bivalents and univalents. Maintain by picking Unc.

Dpy. Unc. meT7 is an end-to-end-to-end fusion of chromosomes III, X, and V. The right end of III is fused to the left end of X, and the right end of X is fused to the left end of IV. Constructed by crossing eT5 and mnT12. meT7 homozygotes produce 92% viable progeny. meT7 heterozygotes are Him and produce many dead eggs.

ynIs78 [flp-8p::GFP]. acEx178 [flp-8p::ced-3 (p15)::nz + flp-32::cz::ced-3 (p17) + unc-122p::RFP]. AUA interneurons ablated in flp-8p::GFP background. GFP-labelled AUA neurons are missing in the neuronal ablated animals. Pick RFP+ animals to maintain. Reference: Filipowicz A, et al. BMC Biol. 2022 Oct 8;20(1):229. doi: 10.1186/s12915-022-01424-x. PMID: 36209082.

ynIs78 [flp-8p::GFP]. acEx179 [flp-21p::ced-3 (p15)::nz + ncs-1p::cz::ced-3 (p17) + unc-122p::RFP]. RMG interneurons ablated in flp-21p::GFP background. GFP-labelled RMG neurons are missing in the neuronal ablated animals. Pick RFP+ animals to maintain. Reference: Filipowicz A, et al. BMC Biol. 2022 Oct 8;20(1):229. doi: 10.1186/s12915-022-01424-x. PMID: 36209082.

Pick animals red-head animal. The marker used was myo-2:mcherry.

Pick animals red animal. The marker used was myo-3:mcherry.

Pick animals with roller. The marker used was rol-6.

acEx189 [rab-3p::unc-30 + myo-2::mCherry]. Pick mCherry+ animals to maintain. Expression of unc-30 driven by rab-3 neuronal promoter rescues unc-30(ok613) in neurons. Reference: Otarigho B & Aballay A. Cell Rep. 2021 May 25;35(8):109187. doi: 10.1016/j.celrep.2021.109187. PMID: 34038721.

acEx190 [tax-2p::CZ::ced-3(p17)::unc-54 3’UTR + lim-6p::ced-3(p15)::NZ::unc-54 3’UTR + myo-3p::mCherry]. Pick mCherry+ to maintain.  ASG is ablated in animals carrying the array by employing a two-component system reconstituted caspase (recCaspase) using the tax-2 and lim-6 promoters.  Strain viable at all temperatures.  Reference Otarigho, B. and Aballay, A., 202. Cell reports, 35(8). PMID: 34038721.

acEx191 [odr-2p::CZ::ced-3(p17)::unc-54 3’UTR+ unc-53p::ced-3(p15)::NZ::unc-54 3’UTR + rol-6(su1006)]. Pick Rollers to maintain.  PVP is ablated in animals carrying the array by employing a two-component system reconstituted caspase (recCaspase) using the odr-2 and unc-53 promoters.  Strain viable at all temperatures.  Reference Otarigho, B. and Aballay, A., 202. Cell reports, 35(8). PMID: 34038721.

Temperature sensitive. Maintain at 15C.

Temperature sensitive. Fertilization abnormal. Recessive.

Homozygous male/hermaphrodite line. Males are fertile. Hermaphrodites are sterile, but slightly leaky producing a few progeny (at 25C - ts not tested). In pronase, spermatids from males activate to form many long spikes, terminating at this stage. A very few (1-3 per worm) activate to form normal-looking, motile spermatozoons.

yanSi1 [eft-3p::dCAS9::VP64::tbb-2 3'UTR + Cbr-unc-119(+)] inserted into ttTi5605 (II:8.42 MB) in parental strain EG6699. Integration plasmid was generated via 3-way gateway reaction with pCFJ150 and plasmids containing eft-3 promoter (ID:1031@E02 promoterome), tbb-2 3'UTR (pCM1.36), and a full length dcas9::VP64 transgene cloned into pDONR201. Reference: Zullo JM, et al. Nature. 2019 Oct;574(7778):359-364. doi: 10.1038/s41586-019-1647-8. PMID: 31619788.

ggIs1 [nrde-3p::3xFlag::GFP::nrde-3 ORF + unc-119(+)] IV. Nuclear GFP::NRDE-3 signal. Lacks RNA editing. Reference: Reich DP, et al. Genes Dev. 2018 Feb 1;32(3-4):271-282.

Enhanced RNAi. Lacks RNA editing. Vulval bursting. Low brood size. Triple mutants display bursting and low brood size phenotypes not observed in adr-1;adr-2 or rrf-3 parental strains. Reference: Reich DP, et al. Genes Dev. 2018 Feb 1;32(3-4):271-282.

RNAi deficient. Lacks RNA editing. Reference: Reich DP, et al. Genes Dev. 2018 Feb 1;32(3-4):271-282.

RNAi deficient. Lacks RNA editing. Reference: Reich DP, et al. Genes Dev. 2018 Feb 1;32(3-4):271-282.

ggIs1 [nrde-3p::3xFlag::GFP::nrde-3 ORF + unc-119(+)] IV. Nuclear GFP::NRDE-3 signal. Enhanced RNAi. Lacks RNA editing. Vulval bursting. Low brood size. Triple mutants display bursting and low brood size phenotypes not observed in adr-1;adr-2 or rrf-3 parental strains. Reference: Reich DP, et al. Genes Dev. 2018 Feb 1;32(3-4):271-282.

Enhanced RNAi. Lacks RNA editing. Vulval bursting. Low brood size. Triple mutants display bursting and low brood size phenotypes not observed in adr-1;adr-2 or rrf-3 parental strains. Reference: Reich DP, et al. Genes Dev. 2018 Feb 1;32(3-4):271-282.

Heterozygotes are WT and segregate WT, Unc-36, dead eggs, and DpyRol. Maintain by picking WT.

srl-2 is a recessive suppressor of the s1040 temperature sensitive lethal phenotype. srl-2 has no effect on the Roller phenotype of s1040. (At 20C, s1040 homozygotes arrest development at mid-larval stage. At 15C, s1040 homozygotes are viable weak left-handed rollers.) Maintain at 20C to select for retention of suppressor. Animals at 20C will be DpyUncRol.

Heterozygotes are WT and segregate WT, Unc-36, DpyUncLet and dead eggs. Maintain by picking WT.

srl-1 is a recessive suppressor of the s1040 temperature sensitive lethal phenotype. srl-1 has no effect on the Roller phenotype of s1040. (At 20C, s1040 homozygotes arrest development at mid-larval stage. At 15C, s1040 homozygotes are viable weak left-handed rollers.) Maintain at 20C to select for retention of suppressor. Animals at 20C will be DpyUncRol.

Left-handed Dpy Roller. Recessive.

Dominant. Heterozygotes are Rollers. Temperature sensitive. At 25C: homozygotes are Sqt; heterozygotes are rollers. AT 16C: homozygotes are WT (a few adults may roll weakly); heterozygotes are WT. M-MATING+LOW TEMP ONLY.

Adults and L4 animals roll left. Recessive. M-MATING++ 1-10%WT. PKA rol-4.

mjIs134 [mex-5p::GFP::(Gly)5Ala::his-58::tbb-2 3'UTR + Cbr-unc-119(+)] II. Germ granule defective. ~30% sterility, maintain by picking gravid adults with visible embryos. Nuclear GFP expression in the germline. Reference: Lev I, et al. Curr Biol. 2019 Sep 9;29(17):2880-2891.e4. PMID: 31378614

mjIs134 [mex-5p::GFP::(Gly)5Ala::his-58::tbb-2 3'UTR + Cbr-unc-119(+)] II. Maintain at 15C. Heritable RNAi deficient, germ granule defective, high sterility. Expresses nuclear GFP in the germline. Reference: Lev I, et al. Curr Biol. 2019 Sep 9;29(17):2880-2891.e4. PMID: 31378614

bqSi577 [myo-2p::GFP + unc-119(+)] IV. Germline granules defective, ~30% sterility. Males fail to be attracted by hermaphrodite-secreted volatile sex pheromones. Express GFP in pharyngeal muscles. Reference: Toker IA, et al. Dev Cell. 2022 Feb 7;57(3):298-309.e9. PMID: 35134343

bqSi577 [myo-2p::GFP + unc-119(+)] IV. Germ granule defective, ~30 sterility. Express GFP in pharyngeal muscles. Reference: Toker IA, et al. Dev Cell. 2022 Feb 7;57(3):298-309.e9. PMID: 35134343

jaaIs2 [semo-1p::GFP::LGALS3]. Hypodermal promoter drives expression of GFP-tagged human Galectin-3, a lysosomal damage reporter. Galectin-3 rapidly accumulates on damaged lysosomes, making this a sensitive in vivo reporter for lysosomal membrane permeabilization. Reference: Aits S, et al. Autophagy. 2015;11(8):1408-24. doi: 10.1080/15548627.2015.1063871. PMID: 26114578.

bqSi189 [lmn-1p::mCherry::his-58 + unc-119(+)] II. ojIs1 [pie-1p::GFP::tbb-2 + unc-119(+)]. Maintain at 25C to help prevent silencing of ojIs1. mel-28 heterozygotes are wild-type and segregate wild-type, DpySteriles, and Uncs which give only dead eggs. ojIs1 is likely integrated into LG V. bqSi189 is a single-copy MosSCI insertion into ttTi5605 derived from injection of pBN13. Derived from GE2622; this strain might still carry him-3(e1147) in the background. Reference: Gomez-Saldivar G, et al. PLoS Genet. 2016 Jun 24;12(6):e1006131.

Weak Hid. Eak.

byIs162 [rab-3p::F3(delta)K280(I277P)(I308P) + myo-2p::mCherry]. bkIs10 [aex-3p::h4R1NtauV337M + myo-2p::GFP]. Strain co-expressing the F3(delta)K280 anti-aggregation Tau fragment (with two I to P substitutions) and full-length Tau in all neurons. Red and green fluorescence in the pharynx due to the co-injection markers. The F3/2P fragment is not able to nucleate aggregation of full length Tau. bkIs10 contains an integrated transgene encoding the 1N4R isoforms of human tau with the 337M FTDP-17 mutation. Expression is driven by the pan-neuronal promoter aex-3. Over-expression of this transgene results in a pronounced Unc phenotype. Reference: Fatouros C, et al. Hum Mol Genet. 2012 Aug 15;21(16):3587-603.

byIs161 [rab-3p::F3(delta)K280 + myo-2p::mCherry]. bkIs10 [aex-3p::h4R1NtauV337M + myo-2p::GFP]. Strain co-expressing the F3(delta)K280 pro-aggregation Tau fragment and full-length Tau in all neurons. Worms have severe locomotion defect and slow growth. Red and green fluorescence in the pharynx due to the co-injection markers. bkIs10 contains an integrated transgene encoding the 1N4R isoforms of human tau with the 337M FTDP-17 mutation. Expression is driven by the pan-neuronal promoter aex-3. Over-expression of this transgene results in a pronounced Unc phenotype. Derived by additional outcrossing of BR5485. Reference: Fatouros C, et al. Hum Mol Genet. 2012 Aug 15;21(16):3587-603.

F42G8.4. No obvious phenotype. Follow by PCR. Predicted gene is a p38 related Map Kinase. Approx. 1.5 kb deletion by agarose gel (not sequenced so end points not known). Nested PCR primers for detecting F42G8.4: F42G8.4EL1 5' - TCGCCCTTTGTATGTCTTCC - 3'. F42G8.4ER1 5' - TTCTCCAGGGATTAACGGTG - 3'. F42G8.4IL1 5' - TTTTCACTGCGTCTCAATCG - 3'. F42G8.4IR1 5' - TTTCAAATTTGCAGGTGTGC - 3'.

Homozygous sterile mutation balanced by GFP- and dpy-10-marked inversion. Heterozygotes are wild-type with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok308 homozygotes (mostly sterile or Mel, but can be slowly propagated at 20C). Pick WT dim GFP and check for correct segregation of progeny to maintain.

Heterozygotes are slow growing with WT phenotype. Hets segregate more slow growing WT, embryonic lethals (ozDf1/ozDf1) and DpyUncs which are sick and have a maternal effect lethal (none of the offspring from the DpyUncs survive to reproduce). Maintain by picking WT.

kqEx73 [pat-3(sp) + rab-3::RFP + cki-1::GFP]. Pick RFP+ to maintain. kqEx73 carries a form of pat-3 gene with splicing defects; rescues pat-3 null allele. pat-3(sp) is a frameshift mutation in the splice acceptor region (ag to aa) that abolishes conserved interaction domains such as the NPxY motifs and creates a splice variant with an extra 19 amino acids. The pat-3(sp) animals not only produce mutant pat-3, but also express the regular splice form due to utilization of an unusual splice acceptor. Abnormal Distal Tip Cell migration and pat-3 gene splicing (intron 7) defects. Reference: Kihira S, et al. PLoS One. 2012;7(8):e42425.

Mild motility and gonad migration defects. pat-3(kq8041) is an engineered Y804A substitution of the membrane distal tyrosine in the cytoplasmic domain. Reference: Hanna J, et al., microPublication Biology. 10.17912/micropub.biology.000291. https://www.micropublication.org/journals/biology/micropub-biology-000291

Motility and cell (DTC) migration defects. pat-3(kq8042) is an engineered Y804E substitution of the membrane distal tyrosine in the cytoplasmic domain. Reference: Hanna J, et al., microPublication Biology. 10.17912/micropub.biology.000291. https://www.micropublication.org/journals/biology/micropub-biology-000291

Mild motility and cell migration defects. pat-3(kq8043) is an engineered Y804F substitution of the membrane distal tyrosine in the cytoplasmic domain. Reference: Hanna J, et al., microPublication Biology. 10.17912/micropub.biology.000291. https://www.micropublication.org/journals/biology/micropub-biology-000291

Slow growing. Unc. Dpy. No delta6 fatty acid desaturase activity.

This strain is tolerant to acute treatment of ethanol. The severity and incidence of stress-induced tremors are greater than in wild-type. Reference: Jee C, et al. Genes Brain Behav. 2013 Mar;12(2):250-62.

Dopamine receptor knockout. [NOTE: (3/3/2025) ok295 was previously described as an allele of dop-3/T14E8.4, but is actually an allele of aaim-1/T14E8.4.1 according to current gene models.] Derived by out-crossing parental strain RB563. Outer Left Sequence: ttgctccagcggttctagtt. Outer Right Sequence: gactgtctaagcgaccagcc. Inner Left Sequence: ttgtttgcgggtttgataca. Inner Right Sequence: agaagcacgcggtagttgat. Inner Primer PCR Length: 3254. Estimated Deletion Size: about 1000 bp.