CX3877 |
C. elegans |
kyIs156 X. Show Description
kyIs156 [str-1p::odr-10(cDNA)::GFP]. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
CHS1265 |
C. elegans |
str-3(yum1042) str-4(yum2669) str-5(yum2670) str-1(yum2671) str-6(yum2672) str-7(yum2673) str-9(yum2674) c04c3.7(yum2675) str-8(yum2676) t23d5.8(yum2677) IV. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
|
|
LE2492 |
C. elegans |
lqIs151. Show Description
lqIs151 [scm::unc-40::GFP + str-1::GFP].
|
|
LE3078 |
C. elegans |
lqEx631. Show Description
lqEx631 [tiam-1::CFP + str-1::GFP]. GFP expression in AWB amphid neurons. CFP neural expression in the head and tail, the ventral cord commissural motorneurons, the mechanosensory neurons (ALMs, PLMs, AVM, PVM) and the CAN, PDE, and PVD neurons. Reference: Demarco RS, et al. PLoS Genet. 2012;8(4):e1002665.
|
|
PY2223 |
C. elegans |
mef-2(oy65) I; kin-29(oy39) kyIs104 X. Show Description
kyIs104 [str-1::GFP]. AWB expression of GFP. mef-2 suppresses the phenotypes of kin-29 (small body size, hypersensitivity to dauer pheromone, reduced expression of the str-1 chemoreceptor in the AWB olfactory neurons). WT looking.
|
|
PY2285 |
C. elegans |
kin-29(oy39) hda-4(oy59) kyIs104 X. Show Description
kyIs104 [str-1::GFP]. AWB expression of GFP. hda-4 suppresses the phenotypes of kin-29 (small body size, hypersensitivity to dauer pheromone, reduced expression of the str-1 chemoreceptor in the AWB olfactory neurons). WT looking.
|
|
PY2289 |
C. elegans |
mef-2(oy63) I; kin-29(oy39) kyIs104 X. Show Description
kyIs104 [str-1::GFP]. AWB expression of GFP. mef-2 suppresses the phenotypes of kin-29 (small body size, hypersensitivity to dauer pheromone, reduced expression of the str-1 chemoreceptor in the AWB olfactory neurons). WT looking.
|
|
SLR248 |
C. elegans |
unc-119(ed3) III; stxEx35. Show Description
stxEx35 [istr-1::TY1::eGFP::3xFLAG + Cbr-unc-119(+)]. Pick non-Unc to maintain. Constitutive expression of GFP. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of istr-1 coding sequence in fosmid WRM0636D_F01 by recombineering (TransgeneOme bacterial clone 5438954842362824 D10). Reference: Radetskaya O, et al. The PMK-3 (p38) Mitochondrial Retrograde Response Functions in Intestinal Cells to Extend Life via the ESCRT Machinery. bioRxiv 797308; doi: https://doi.org/10.1101/797308
|
|
VC1240 |
C. elegans |
mstr-1(ok1685) I. Show Description
F22D6.2. Superficially wild type. External left primer: ACTCTCCTCCCCGTCATCTT. External right primer: CCACATGAGTGGGTGTCTTG. Internal left primer: ATCAACTGATCGCCAGGAAC. Internal right primer: CTTGTGACCTGCCTCTCCTC. Internal WT amplicon: 2103 bp. Deletion size: 1041 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
CHS1010 |
C. elegans |
str-112(yum1145) str-113(yum1146) str-114(yum1147) str-115(yum1148) str-116(yum1149) str-118(yum1150) V. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
|
|
CHS1030 |
C. elegans |
str-148(yum1223) II; str-141(yum1224) str-146(yum1222) str-145(yum1221) str-149(yum1225) str-151(yum1227) str-150(yum1226) V. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
|
|
CHS1035 |
C. elegans |
str-153(yum1271) IV; str-154(yum1280) V; str-155(yum1272) str-156(yum1275) str-158(yum1276) str-159(yum1277) IV; str-160(yum1278) V; str-161(yum1279) str-162(yum1273) str-168(yum1274) IV; str-267(yum1281) V. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
|
|
CHS1049 |
C. elegans |
str-176(yum1363) IV; str-177(yum1364) str-178(yum1365) str-180(yum1366) str-181(yum1367) str-182(yum1368) V. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
|
|
CHS1067 |
C. elegans |
str-96(yum1435) str-97(yum1436) str-99(yum1437) str-101(yum1438) str-102(yum1439) str-103(yum1440) V. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
|
|
CHS1075 |
C. elegans |
str-166(yum1476) str-169(yum1477) str-163(yum1473) str-164(yum1474) IV; str-165(yum1475) V. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
|
|
CHS1098 |
C. elegans |
str-12(yum1563) str-13(yum1564) str-106(yum1565) str-108(yum1566) str-109(yum1567) str-111(yum1568) f10a3.12(yum1569) k05d4.9(yum1570) V; str-10(yum1562) X. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
|
|
CHS1172 |
C. elegans |
str-13(yum2029) str-14(yum2026) str-15(yum2027) str-16(yum2028) str-18(yum2030) str-19(yum2031) str-20(yum2032) str-23(yum2033) str-25(yum2034) f22b8.3(yum2035) V. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
|
|
CHS1176 |
C. elegans |
str-170(yum2047) str-171(yum2048) str-172(yum2049) str-173(yum2050) str-174(yum2051) str-175(yum2052) str-166(yum2053) y9c9a.5(yum2054) IV. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
|
|
CHS1182 |
C. elegans |
str-196(yum2084) str-198(yum2085) str-199(yum2086) str-200(yum2087) str-204(yum2088) str-205(yum2089) str-193(yum2090) str-2(yum2091) str-3(yum2092) V. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
|
|
CHS1183 |
C. elegans |
str-185(yum2093) str-188(yum2094) str-187(yum2095) str-190(yum2096) str-178(yum2097) y116a8c.40(yum2098) IV. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
|
|
CHS1189 |
C. elegans |
str-138(yum2131) str-139(yum2132) str-140(yum2133) str-143(yum2134) str-144(yum2135) V. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
|
|
CHS1254 |
C. elegans |
str-119(yum2582) str-121(yum2583) y45g12c.10(yum2585) str-120(yum2586) y45g12c.6(yum2587) V. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
|
|
CHS1276 |
C. elegans |
str-123(yum2774) str-124(yum2775) str-125(yum2776) str-129(yum2777) str-130(yum2778) str-131(yum2779) str-134(yum2780) str-135(yum2781) str-136(yum2782) str-145(yum2783) t06c12.11(yum2784) X. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
|
|
CX3553 |
C. elegans |
lin-15B&lin-15A(n765) kyIs104 X. Show Description
kyIs104 [str-1p::GFP] X. AWB expression of GFP.
|
|
JN1715 |
C. elegans |
peIs1715. Show Description
peIs1715 [str-1p::mCasp-1 + unc-122p::GFP]. AWB neurons are eliminated. Abnormal odor chemotaxis. Reference: Yoshida K, et al. Nat Commun. 2012 Mar 13;3:739.
|
|
OH14277 |
C. elegans |
pha-1(e2123) III; him-5(e1490) V; otEx6640. Show Description
otEx6640 [str-121p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218.
|
|
OH14279 |
C. elegans |
pha-1(e2123) III; him-5(e1490) V; otEx6642. Show Description
otEx6642 [str-178p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218.
|
|
OH14374 |
C. elegans |
pha-1(e2123) III; him-5(e1490) V; otEx6715. Show Description
otEx6715 [str-102p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218.
|
|
OH14380 |
C. elegans |
pha-1(e2123) III; him-5(e1490) V; otEx6721. Show Description
otEx6721 [str-114p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218.
|
|
OH14388 |
C. elegans |
pha-1(e2123) III; him-5(e1490) V; otEx6730. Show Description
otEx6730 [str-123p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218.
|
|
OH14390 |
C. elegans |
pha-1(e2123) III; him-5(e1490) V; otEx6732. Show Description
otEx6732 [str-125p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218.
|
|
OH14392 |
C. elegans |
pha-1(e2123) III; him-5(e1490) V; otEx6734. Show Description
otEx6734 [str-129p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218.
|
|
OH14394 |
C. elegans |
pha-1(e2123) III; him-5(e1490) V; otEx6736. Show Description
otEx6736 [str-130p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218.
|
|
OH14396 |
C. elegans |
pha-1(e2123) III; him-5(e1490) V; otEx6738. Show Description
otEx6738 [str-143p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218.
|
|
OH14398 |
C. elegans |
pha-1(e2123) III; him-5(e1490) V; otEx6740. Show Description
otEx6740 [str-148p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218.
|
|
OH14785 |
C. elegans |
kyIs140 I; oig-8(ot818) II; otTi22. Show Description
kyIs140: [str-2::GFP + lin-15(+)] I. otTi22 [str-1p::oig-8 + NeoR]. Single-copy mini-Mos insertion of rescuing str-1p::oig-8 transgene.
|
|
PS8565 |
C. elegans |
syIs666; syIs300. Show Description
syIs666 [str-1p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)]. cGAL driver for AWB neurons. syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector. Some worms do not express ttx-3p::RFP marker, but will consistently produce worms with the transgenic marker in next generation.
|
|
RB1306 |
C. elegans |
str-182(ok1419) V. Show Description
C12D8.1 Homozygous. Outer Left Sequence: aacatggctttttctggcac. Outer Right Sequence: aaagggaaaattgggcaaag. Inner Left Sequence: acggtgcaaacattggtaca. Inner Right Sequence: ttcgaccttgcttcgaaagt. Inner Primer PCR Length: 2264. Estimated Deletion Size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VC1784 |
C. elegans |
str-148(gk3036) II; T28F3.1(gk1230) IV. Show Description
T28F3.1, M01D1.1. The allele gk1230 was identified by PCR, validated by CGH, and can be detected with the following PCR primers. External left primer: CATGGTCAACGAAGCTGAGA. External right primer: GAGAGGCAGAACCGAAGTTG. Internal left primer: TGCGACGAGATCTTGAAGTG. Internal right primer: AAAGCACATTTGGGCAAGAC. Internal WT amplicon: 2703 bp. Deletion size: 1246 bp. Deletion left flank: TTATTCTCTTTTCCCCCAAATCCCCTATAT. Deletion right flank: GGCAAATGGATAGCACGGATCTGAAATTAA. The allele gk3036 was identified by CGH but not confirmed by PCR. Left flanking probe: CTTGTTGCCCATCTCTGATTTACAACTCGGCCCATAGCGTAATTAAAAAT. Right flanking probe: GATATCCCTTCGAGAATAATATCAAAGTTAAATGTATCTTCATGTCGTTG. Left deleted probe: CACTCCAATTTTCCACGAAAATGCTTTGGCTGCATATCATACAATATTCT. Right deleted probe: ACTACCAGTTCACGTGCAGTTTGAGTTTGTTTCATCAAACCCATTAAAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VC2742 |
C. elegans |
unc-30(gk3024) Y67A10A.104(gk3025) IV; str-183(gk3061) V; ZC374.2(gk1222) X. Show Description
ZC374.2, B0564.10, Y67A10A.104, T13F3.1. The allele gk1222 was identified by PCR, validated by CGH, and can be detected with the following PCR primers. External left primer: TTGGAAGTTTTGGCAGGAAT. External right primer: CTTGCGTTAATCGCATGTGT. Internal left primer: TCCAATTTGAGCGATCAGTG. Internal right primer: AGGACGCGCAGATTGTTAGT. Internal WT amplicon: 2448 bp. Deletion size: 1618 bp. Deletion left flank: CATTTTTCAGTGCTGTTTCTTCCACATTAT. Deletion right flank: TCAGATCTTCTAACTCGCGTTTCTAACTTT. The allele gk3024 was identified by CGH but not confirmed by PCR. Left flanking probe: TTTCGACTGCTGCAAATTTGGCACCTCTACCAACGTGAGTTTTACGGATA. Right flanking probe: TTGTTTGAGCTGCCGGGATGCCAGGAGGAGGGAACAGACAGAGCAGGTAT. Left deleted probe: AAAAATTATAATTTACATTTTTCCAGAGCCCAAGCTGCATTCTCCACATC. Right deleted probe: TTCCTCATCGCTCGGCCAACCTTATCAACCCTGTCAGTACAGTGGACCAC. The allele gk3025 was identified by CGH but not confirmed by PCR. Left flanking probe: GGGATTCGTGGTCGAGATTGCCAGTCCAAGGCTTGGTCGGTTTCAGGTTG. Right flanking probe: GGTTAATGTGAAACTTGATTTAACTGTTCCACGAGTATGCTTTAACAATA. Left deleted probe: TGATTCGCAAAAACAACGAATTGTATAGAACTCACACTTTAAGACATCTA. Right deleted probe: AAATTGCTTACTGACTTTGATGCAAAACAGGTGATTTTTCGGGTTCTAAA. The allele gk3061 was identified by CGH but not confirmed by PCR. Left flanking probe: CAGATTATCTCACTTACTGTTATTGCATATTGTGGGACATGTTGCTACTA. Right flanking probe: GGATCACATACTAAACTTAATTCTTTTCAGACCGCAATACCAATGCTTCT. Left deleted probe: ATATTGTGGGACATGTTGCTACTATAAAATACAACAGCAAATGAGGGTTG. Right deleted probe: ACCTACATCGTCAACTGTTCTACGCTTTGGCAATCCAGGTTTGACGCAGC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|