| CHS1272 |
C. elegans |
srbc-1(yum2739) srbc-2(yum2740) srbc-3(yum2741) srbc-5(yum2742) srbc-6(yum2743) srbc-7(yum2744) srbc-8(yum2745) srbc-9(yum2746) srbc-10(yum2747) srbc-11(yum2748) V. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
|
|
| CHS1152 |
C. elegans |
srbc-50(yum1894) srbc-51(yum1895) srbc-67(yum1896) srbc-68(yum1897) srbc-70(yum1898) srbc-71(yum1899) V. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
|
|
| CHS1246 |
C. elegans |
srbc-75(yum2851) srbc-76(yum2852) srbc-77(yum2853) srbc-78(yum2854) srbc-79(yum2855) srbc-82(yum2856) srbc-83(yum2857) srbc-84(yum2858) srbc-81(yum2859) y19d10a.17(yum2860) V. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
|
|
| OH14971 |
C. elegans |
pha-1(e2123) III; him-5(e1490) V; otEx6964. Show Description
otEx6964 [srbc-7p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218.
|
|
| VC4135 |
C. elegans |
fbxa-182(gk5217) II; srbc-70(gk5218) IV. Show Description
Homozygous viable. Nonsense alleles identified by amplicon sequencing. The gk5217 mutation is C->T, flanking sequences GCTGATGCGGACATCCAACTTAGTTAAAAT and CATTCATTTGTGGCTTGACATAAATTATAT. The gk5218 mutation is C->T, flanking sequences GTGATCAGTTCTATTTTTGGTGCAGAACTT and CAGACGAAAAGTCGAATGGCAAGAACTGCT.
|
|