More Fields
Strain Species Genotype
CX3695 C. elegans kyIs140 I. Show Description
kyIs140 [str-2::GFP + lin-15(+)] I. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
RB2316 C. elegans str-2(ok3148) V. Show Description
C50C10.7 Homozygous. Outer Left Sequence: tcgacctgtcaaacatcgaa. Outer Right Sequence: cgcatttgtgaacctgtttg. Inner Left Sequence: aaatcctcgtcgataacttttga . Inner Right Sequence: gcacacatatgggtctgcttt. Inner Primer PCR Length: 1212. Deletion size: about 300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2413 C. elegans str-2(ok3089) V. Show Description
C50C10.7. External left primer: TCGACCTGTCAAACATCGAA. External right primer: CGCATTTGTGAACCTGTTTG. Internal left primer: AAATCCTCGTCGATAACTTTTGA. Internal right primer: GCACACATATGGGTCTGCTTT. Internal WT amplicon: 1213 bp. Deletion size: 409 bp. Deletion left flank: TCTATCATCTCAAGCTTTTTGGTCAGCCAA. Deletion right flank: TGAATCGAAGTCCGGAAACAAGTAGTTATT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
CX3933 C. elegans kyIs140 I; slo-1(ky389) V. Show Description
kyIs140 [str-2::GFP + lin-15(+)]. ky389 is semi-dominant. str-2::GFP is expressed in both AWC neurons in ky389 mutants. PKA nsy-3(ky389).
CX4998 C. elegans kyIs140 I; nsy-1(ky397) II. Show Description
kyIs140 [str-2::GFP + lin-15(+)] I. In nsy-1 mutants str-2::GFP is expressed in both AWC neurons.
CX5757 C. elegans kyIs140 I; nsy-4(ky616) IV. Show Description
kyIs140 [str-2::GFP + lin-15(+)] I. 2-AWC OFF.
CX5893 C. elegans kyIs140 I; ceh-36(ky646) X. Show Description
kyIs140 [str-2::GFP + lin-15(+)] I. In ceh-36 mutants, both AWC cells fail to take on the AWC fate. ceh-36 is also required for the specification of the ASEL identity. ceh-36 encodes a member of the OTX/OTD family of homeodomain proteins. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
CX5922 C. elegans kyIs140 I; ceh-36(ky640) X. Show Description
kyIs140 [str-2::GFP + lin-15(+)] I. In ceh-26 mutants, both AWC cells fail to take on the AWC fate. ceh-36 is also required for the specification of the ASEL identity. ceh-36 encodes a member of the OTX/OTD family of homeodomain proteins. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
OH4768 C. elegans kyIs140 I; ttx-3(mg158) X. Show Description
kyIs140 [str-2::GFP + lin-15(+)] I.
PY1133 C. elegans unc-130(oy10) II. Show Description
Slighty Dpy. Slighty Unc. Ventral clear patch due to distal tip cell migration defects. Ectopic expression of AWA neuronal markers.
CX3940 C. elegans kyIs140 I; rol-6(e187) II; slo-1(ky399) V. Show Description
kyIs140 [str-2::GFP + lin-15(+)] I. In ky399 mutants str-2::GFP is expressed in both AWX neurons. ky399 is a semi-dominant allele of slo-1, a large conductance potassium channel. PKA nsy-3(ky399). Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
CX4828 C. elegans kyIs140 I; tir-1(ky388) III; him-5(e1490) V. Show Description
kyIs140 [str-2::GFP + lin-15(+)] I. Him. In tir-1 mutants str-2::GFP is expressed in both AWC neurons.
AT28 C. elegans kyIs140 I; srf-6(yj13) unc-4(e120) II. Show Description
kyIs140 [str-2::GFP + lin-15(+)] I. Kinker; can't back up. srf-6 mutants express str-2::GFP in both AWC neurons (2AWC ON phenotype; wild-type phenotype is 1AWC ON): check for this phenotype to avoid reversion of srf-6(yj13). srf-6 mutants were originally identified by binding of an L1-specific antibody in later larval stages (L1-L4).
AT30 C. elegans kyIs140 I; nsy-1(ok593) unc-4(e120) II. Show Description
kyIs140 [str-2::GFP + lin-15(+)] I. nsy-1(ky593) has no visible phenotype, but can be tracked by linked Unc-4 phenotype (Kinker, can't back up). str-2::GFP is expressed in both AWC neurons.
CX17256 C. elegans kyIs722. Show Description
kyIs722 [str-2p::GCaMP5(D380Y) + elt-2::mCherry]. GCaMP5a expression driven by str-2 promoter, providing a very bright integrated calcium indicator useful for imaging of AWC(on).
IX3447 C. elegans kyIs140 I; vyEx1462. Show Description
kyIs140 [str-2::GFP + lin-15(+)] I. vyEx1462 (die-1(fosmid)::Venus + odr-1::DsRed + ofm-1::DsRed). Pick animals with DsRed+ coelomocytes to maintain. Animals with vyEx1462 show 2AWC(OFF) phenotype. Extrachromosomal array rescues die-1(w34).
IX3597 C. elegans kyIs140 I; vyEx1510. Show Description
kyIs140 [str-2::GFP + lin-15(+)] I. vyEx1510 (ceh-36p::die-1(cDNA) + odr-1::DsRed + ofm-1::DsRed). Pick animals with DsRed+ coelomocytes to maintain. Animals with vyEx1510 show 2AWC(OFF) phenotype.
JC2209 C. elegans olrn-1(ut305) X. Show Description
Butanone enhancement abnormal. Abnormal chemotaxis to x1/1000 butanone. 2AWC-OFF (no expression of str-2::GFP in either of the two AWC neurons. Allelic to nsy-6(ky626).
OH14783 C. elegans kyIs140 I; oig-8(ot818) II; otTi20. Show Description
kyIs140: [str-2::GFP + lin-15(+)] I. otTi20 [oig-8p::oig-8 + NeoR]. Single-copy mini-Mos insertion of rescuing oig-8p::oig-8 transgene.
OH14785 C. elegans kyIs140 I; oig-8(ot818) II; otTi22. Show Description
kyIs140: [str-2::GFP + lin-15(+)] I. otTi22 [str-1p::oig-8 + NeoR]. Single-copy mini-Mos insertion of rescuing str-1p::oig-8 transgene.
OH14864 C. elegans kyIs140 I; oig-8(ot818) II; otTi24. Show Description
kyIs140: [str-2::GFP + lin-15(+)] I. otTi24 [ceh-36(prom3)::oig-8 + NeoR]. Single-copy mini-Mos insertion of rescuing ceh-36(prom3)::oig-8 transgene.
LBV3 C. elegans str-217(ejd3) V. Show Description
DEET-resistant. ejd3 causes a P314S substitution in str-217. Reference: Dennis EJ, et al. Nature. 2018 Oct;562(7725):119-123.
LBV5 C. elegans str-217(ejd1) V. Show Description
DEET-resistant. ejd1 is a CRISPR/Cas9-induced mutation causing a predicted frame-shift in the first exon. WT (affected sequence between arrows): GCTTTTATTCCAAAAAACTCTCTCCCGCGTCG>CTGCTCCAAAAAAAAAA
OH14281 C. elegans pha-1(e2123) III; him-5(e1490) V; otEx6644. Show Description
otEx6644 [str-231p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218.
OH14283 C. elegans pha-1(e2123) III; him-5(e1490) V; otEx6646. Show Description
otEx6646 [str-233p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218.
OH14285 C. elegans pha-1(e2123) III; him-5(e1490) V; otEx6648. Show Description
otEx6648 [str-247p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218.
OH14287 C. elegans pha-1(e2123) III; him-5(e1490) V; otEx6650. Show Description
otEx6650 [str-261p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218.
OH14369 C. elegans pha-1(e2123) III; him-5(e1490) V; otEx6726. Show Description
otEx6726 [str-253p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218.
OH14384 C. elegans pha-1(e2123) III; him-5(e1490) V; otEx6725. Show Description
otEx6725 [str-262p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218.
OH14386 C. elegans pha-1(e2123) III; him-5(e1490) V; otEx6728. Show Description
otEx6728 [str-250p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218.
OH14400 C. elegans pha-1(e2123) III; him-5(e1490) V; otEx6742. Show Description
otEx6742 [str-236p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218.
OH14402 C. elegans pha-1(e2123) III; him-5(e1490) V; otEx6744. Show Description
otEx6744 [str-249p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218.
PS8496 C. elegans syIs627; syIs300. Show Description
syIs627 [str-2p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)]. cGAL driver for AWC neurons. syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector.
RB2404 C. elegans str-220(ok3289) IV. Show Description
C42D4.9 Homozygous. Outer Left Sequence: tgtaacacggcaggttcaaa. Outer Right Sequence: acattccgttttccatttgc. Inner Left Sequence: ttggcgccacttcttcttta. Inner Right Sequence: ccagactgtccaaaatccaga. Inner Primer PCR Length: 1146. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2447 C. elegans str-220(ok3374) IV. Show Description
C42D4.9 Homozygous. Outer Left Sequence: tgtaacacggcaggttcaaa. Outer Right Sequence: acattccgttttccatttgc. Inner Left Sequence: ttggcgccacttcttcttta. Inner Right Sequence:ccagactgtccaaaatccaga . Inner Primer PCR Length: 1146. Deletion size: about 300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
SRS230 C. elegans pha-1(e2123) III; lite-1(ce314) X; sraEx230. Show Description
sraEx230 [str-2p::Arch::TagRFP + pBX(pha-1(+))]. Maintain at 25C. This transgenic line expresses TagRFP in AWC(on) and has little response to blue light in the absence of ATR. In the presence of ATR the reversal rate of the animal is decreased upon symmetrical stimulation, and asymmetrical stimulation causes the worm to turn in the same direction the head was bent when AWC(on) was inhibited. Reference: Kocabas A, et al. Nature. 2012 Sep 23. doi: 10.1038/nature11431.
SRS301 C. elegans pha-1(e2123) III; lite-1(ce314) X; sraEx301. Show Description
sraEx301 [str-2p::chop-2(H134R)::TagRFP + str-2p::TagRFP + pBX(pha-1(+))]. Maintain at 25C. This transgenic line expresses TagRFP in AWC(on) and has little response to blue light in the absence of ATR. In the presence of ATR the reversal rate of the animal is increased upon symmetrical stimulation, and asymmetrical stimulation causes the worm to turn in the opposite direction to which the head was bent when AWC(on) was excited. Reference: Kocabas A, et al. Nature. 2012 Sep 23. doi: 10.1038/nature11431.
VC3263 C. elegans zip-3(gk3164) II; str-260(gk3267) gkDf41 V. Show Description
This strain is homozygous for a deletion (gk3164) in W07G1.3, detectable by PCR using the following primers. External left primer: CAGGCTGATCCATTACGGTT. External right primer: TTCCCTGTCTCCAAAAATGC. Internal left primer: CGTATCAACTGGAATCGGGT. Internal right primer: GCTCCGAGCTCTCCCTATTT. Internal WT amplicon: 2525 bp. Deletion size: 1275 bp. Deletion left flank: AGTGTTTCAATTCGGCTTGATCTACGTAGA. Deletion right flank: ATGAATAGACCACGACCATTTTCTGGGCGG. Validation: gk3164 passed by CGH. Other deletions (gk3267, gkDf41) identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3881 C. elegans str-211(gk3767) I. Show Description
Homozygous viable. Splicing defect identified by amplicon sequencing.