Search Strains

More Fields See WormTagDB for other published tagged loci.
Strain Species Genotype Add
RB1304 C. elegans wdr-5.1(ok1417) III. Show Description
C14B1.4 Homozygous. Outer Left Sequence: acgctgaagacgaggatgat. Outer Right Sequence: aatatcggcaattacgcagg. Inner Left Sequence: attgtgtgttcgctgtgcat. Inner Right Sequence: cgtatttgctctcggtcgat. Inner Primer PCR Length: 2239. Estimated Deletion Size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
ABR161 C. elegans hjIs37; ldrIs1. Show Description
hjIs37 [vha-6p::mRFP-PTS1 + Cbr-unc-119(+)]. ldrIs1 [dhs-3p::dhs-3::GFP + unc-76(+)]. mRFP targeted to peroxisomes in intestinal cells. dhs-3::GFP is expressed mainly in intestinal cells and localized to intestinal lipid droplets. Derived by crossing parental strains VS10 and LIU1 and outcrossing six times to ABR lab stock of N2. Reference: Papsdorf K, et al. Nat Cell Biol. 2023 May;25(5):672-684. doi: 10.1038/s41556-023-01136-6. 2023. PMID 37127715.
AC257 C. elegans ppk-3(n2668) X. Show Description
Growth retardation, enlarged vacuoles (late endosomes and lysosomes) in intestine, epidermis, coelomocytes and pharynx. 27% embryonic lethality and 8% post-embryonic lethality.
AD200 C. elegans unc-119(ed3) III; asIs1. Show Description
asIs1 [pie-1p::GFP::egg-3 + unc-119(+)].
AD226 C. elegans egg-3(tm1191)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP+ (heterozygotes), Dpy bright GFP+ (mIn1 homozygotes), and non-GFP tm1191 homozygotes. Pick WT dim GFP and check for correct segregation of progeny to maintain.
AD238 C. elegans asIs2. Show Description
asIs2 [pie-1p::mCherry::egg-3].
AD309 C. elegans spe-21(syb4299) III; asEx98. Show Description
asEx98 [spe-21(+) + myo-3::GFP]. Pick GFP+ animals to maintain. syb(4299) is a non-conditional allele of spe-21. Mutant hermaphrodites and males are severly subfertile. Array carries a fragment (PCR product) of R13F6.5 containing a wild-type copy spe-21(+). spe-21/R13F6.5 formerly known as dhhc-5. The extrachromosomal array effectively rescues the fertility defect. Reference: Suryanarayanan S, et al. bioRxiv 2025.03.03.641263; doi: https://doi.org/10.1101/2025.03.03.641263.
AF1 C. elegans +/szT1 [lon-2(e678)] I; dpy-8(e1321) unc-3(e151)/szT1 X. Show Description
Heterozygotes are WT and segregate WT, DpyUnc, dead eggs and Lon males. Maintain by picking WT.
AG166 C. elegans mdf-2(av16) unc-17(e245) IV. Show Description
Reduced brood size. Reduced hatching. Slow growth. Larval lethal. Larval arrest. Bursts at vulva. Suppresses the mat-3 one-cell arrest at 25C.
AGD1101 C. elegans uthIs372. Show Description
uthIs372 [sur-5p::pat-10::unc-54 3'UTR + myo-2p::tdTomato::unc-54 3' UTR]. Long-lived, thermotolerant. Reference: Baird NA, et al. Science. 2014 Oct 17;346(6207):360-3.
AGD710 C. elegans uthIs235. Show Description
uthIs235 [sur-5p::hsf-1::unc-54 3'UTR + myo-2p::tdTomato::unc-54 3' UTR]. Long-lived, thermotolerant. Small brood size. Reference: Baird NA, et al. Science. 2014 Oct 17;346(6207):360-3.
AGD794 C. elegans hsf-1 (sy441) I; uthIs225. Show Description
uthIs225 [sur5p::hsf-1(CT-Delta)::unc-54 3'UTR + myo-2p::tdTomato::unc-54 3' UTR]. Long-lived, thermotolerant. Small brood size. Reference: Baird NA, et al. Science. 2014 Oct 17;346(6207):360-3.
AGD885 C. elegans rrf-3(b26) II; fem-1(hc17) IV; uthEx633. Show Description
uthEx633 [myo-3p::GFP]. Maintain at 15C; sterile at 25C. Pick animals with GFP expression in body wall muscle to maintain. Reference: Vilchez D, et al. Nature. 2012 Sep 13;489(7415):263-8.
AGD886 C. elegans rrf-3(b26) II; fem-1(hc17) IV; uthEx557. Show Description
uthEx557 [sur-5p::rpn-6 + myo-3p::GFP]. Maintain at 15C; sterile at 25C. Pick animals with GFP expression in body wall muscle to maintain. Reference: Vilchez D, et al. Nature. 2012 Sep 13;489(7415):263-8.
AH4617 C. elegans pat-3(zh115[pat-3::gfp]) III Show Description
wild-type morphology. Endogenous gfp reporter for pat-3
AMJ565 C. elegans jamSi6 II; rde-4(ne301) III. Show Description
jamSi6 [nas-9p::rde-4(+)::rde-4 3' UTR + unc-119(+)] II. Enables RNAi silencing in body wall muscles in an otherwise rde-4(ne301) background. jamSi6 was integrated into ttTi5605 II in an EG4322 background using MosSCI. Unknown if unc-119(ed9) is still present or homozygous in background. An isolated inserted line was crossed into AMJ8 (juIs73 [unc-25p::GFP] III) to temporarily balance the endogenous rde-4 locus during the subsequent cross; resulting jamSi6 heterozygous males were crossed into WM49 (rde-4(ne301) III). rde-4(ne301) presumed to be homozygous in this strain due to crossing strategy and minimal recombination between rde-3 and juIs73. Reference: Raman P, et al. Nucleic Acids Res. 2017 Aug 21;45(14):8463-8473. doi: 10.1093/nar/gkx484. PMID: 28541563.
AMJ912 C. elegans jamSi28 II; rde-4(ne301) III. Show Description
jamSi28 [myo-3p::rde-4(+)::rde-4 3' UTR + unc-119(+)] II. Enables RNAi silencing in body wall muscles in an otherwise rde-4(ne301) background. jamSi28 was integrated into ttTi5605 II in an EG4322 background using MosSCI. Unknown if unc-119(ed9) is still present or homozygous in background. An isolated inserted line was crossed into AMJ8 (juIs73 [unc-25p::GFP] III) to temporarily balance the endogenous rde-4 locus during the subsequent cross; resulting jamSi28 heterozygous males were crossed into WM49 (rde-4(ne301) III). rde-4(ne301) presumed to be homozygous in this strain due to crossing strategy and minimal recombination between rde-3 and juIs73. Reference: Raman P, et al. Nucleic Acids Res. 2017 Aug 21;45(14):8463-8473. doi: 10.1093/nar/gkx484. PMID: 28541563.
AML10 C. elegans otIs355; otIs45 V. Show Description
otIs355 [rab-3::NLS::tagRFP]. otIs45 [unc-119::GFP] V. Pan-neural expression with no injection marker. Reference: Nguyen JP, et al. Proc Natl Acad Sci U S A. 2016 Feb 23;113(8):E1074-81.
AML310 C. elegans wtfIs5; wtfEx258. Show Description
wtfIs5 [rab-3p::NLS::GCaMP6s + rab-3p::NLS::tagRFP]. wtfEx258 [rig-3p::tagBFP::unc-54 3'UTR]. Pick BFP+ animals to maintain transgene. Integrated calcium indicator GCaMP6s and calcium-insensitive fluorescent protein RFP in the nuclei of all neurons for whole brain imaging. BFP expression from rig-3 promoter allows identification of AVAL/R neurons. Reference: Hallinen KM, et al. eLife. 2021 Jul 29;10:e66135. doi: 10.7554/eLife.66135.
AML318 C. elegans otIs669 V. Show Description
Derived by out-crossing parental strain OH15262 an additional six times to N2. Out-crossed strain AML318 seems healthier than parental strain when maintaining long-term under normal conditions (AML observed an increase in male and sterile progeny in parental strain in successive generations.) otIs669 [UPN::NLS::TagRFP-T + acr-5::NLS::mTagBFP2::H2B + flp-1::NLS::mTagBFP2::H2B + flp-6::NLS::mTagBFP2::H2B + flp-18::NLS::mTagBFP2::H2B + flp-19::NLS::mTagBFP2::H2B + flp-26::NLS::mTagBFP2::H2B + gcy-18::NLS::mTagBFP2::H2B + ggr-3::NLS::mTagBFP2::H2B + lim-4::NLS::mTagBFP2::H2B + pdfr-1::NLS::mTagBFP2::H2B + srab-20::NLS::mTagBFP2::H2B + unc-25::NLS::mTagBFP2::H2B + cho-1::NLS::CyOFP1::H2B + flp-13::NLS::CyOFP1::H2B + flp-20::NLS::CyOFP1::H2B + gcy-36::NLS::CyOFP1::H2B + gpa-1::NLS::CyOFP1::H2B + nlp-12::NLS::CyOFP1::H2B + nmr-1::NLS::CyOFP1::H2B + ocr-1::NLS::CyOFP1::H2B + osm-9::NLS::CyOFP1::H2B + srh-79::NLS::CyOFP1::H2B + sri-1::NLS::CyOFP1::H2B + srsx-3::NLS::CyOFP1::H2B + unc-8::NLS::CyOFP1::H2B + acr-2::NLS::mNeptune2.5 + ceh-2::NLS::mNeptune2.5 + dat-1::NLS::mNeptune2.5 + dhc-3::NLS::mNeptune2.5 + eat-4::NLS::mNeptune2.5 + flp-3::NLS::mNeptune2.5 + gcy-35::NLS::mNeptune2.5 + glr-1::NLS::mNeptune2.5 + gcy-21::NLS::CyOFP1::H2B::T2A::NLS::mTagBFP2::H2B + klp-6::NLS::mNeptune2.5::T2A::NLS::CyOFP1::H2B + lim-6::NLS::mNeptune2.5::T2A::NLS::CyOFP1::H2B + mbr-1::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B + mec-3::NLS::CyOFP1::H2B::T2A::NLS::mTagBFP2::H2B + odr-1::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B + srab-20::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B] V. UPN (Ultra Pan-Neuronal) promoter contains four short pan-neuronal promoters fused together (unc-11::rgef-1::ehs-1::ric-19). NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene used to resolve unique neural identities in whole-brain images. Reference: Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642.
AML376 C. elegans juSi164 unc-119(ed3) III; wtfEx296. Show Description
juSi164 [mex-5p::HIS-72::miniSOG + Cbr-unc-119(+)] III. wtfEx296 [rab-3p::AI::gur-3G::unc-54 3'UTR + rab-3p::AI::prdx-2G::SL2::his-24::tagRFP::unc-54 3'UTR + rab-3p::his-24::GCaMP6s::unc-54 3'UTR]. Pick RFP+ to maintain. Keep plates covered to avoid unnecessary exposure to light. Worms expressing a purple light-sensitive optogenetic protein system: pan-neuronal expression of GUR-3 and PRDX-2 with nuclear-localized tagRFP and GCaMP6s. Reporter construct contains an artificial intron (AI). Reference: Sharma AK, et al. Genetics 2024 May 11:iyae077. doi: 10.1093/genetics/iyae077 PMID: 38733622.
AML405 C. elegans juSi164 unc-119(ed3) III; wtfEx315. Show Description
juSi164 [mex-5p::HIS-72::miniSOG + Cbr-unc-119(+)] III. wtfEx315 [5xQUAS::(delta)pes-10P::AI::gur-3G::unc-54 3'UTR + 5xQUAS::(delta)pes-10P::AI::prdx-2G::unc-54 3'UTR + rab-3p::AI::QF+hGR::unc-54 3'UTR + unc-122p::GFP]. Pick animals with GFP+ coelomocytes to maintain. Worms expressing a purple light-sensitive optogenetic protein system: pan-neuronal expression of GUR-3 and PRDX-2. Reporter construct contains an artificial intron (AI). Reference: Sharma AK, et al. Genetics 2024 May 11:iyae077. doi: 10.1093/genetics/iyae077 PMID: 38733622.
AML456 C. elegans wtfIs348. Show Description
wtfIs348 [pAS3-5xQUAS::(delta)pes-10p::AI::gur-3G::unc-54 3' UTR + pAS3-5xQUAS::(delta)pes-10p::AI::prdx-2G::unc-54 3' UTR + pAS-3-rab-3p::AI::QF+GR::unc-54 3' UTR + unc-122::GFP]. Keep plates covered to avoid unnecessary exposure to light. This strain expresses a purple light-sensitive optogenetic protein system (i.e., GUR-3 and PRDX-2) in each neuron, and GFP in coelomocytes. Reference: Randi F, et al. Nature 2023 Nov;623(7986):406-414. doi: 10.1038/s41586-023-06683-4. PMID: 37914938. Sharma AK, et al. Genetics 2024 May 11:iyae077. doi: 10.1093/genetics/iyae077 PMID: 38733622.
AML462 C. elegans otIs669 V; wtfIs145; wtfIs348. Show Description
wtfIs145 [rab-3p::his-24::GCaMP6s::unc-54 3' UTR + pBX]. wtfIs348 [pAS3-5xQUAS::(delta)pes-10p::AI::gur-3G::unc-54 3' UTR + pAS3-5xQUAS::(delta)pes-10p::AI::prdx-2G::unc-54 3' UTR + pAS3-rab-3p::AI::QF+GR::unc-54 3' UTR + unc-122::GFP]. Keep plates covered to avoid unnecessary exposure to light. This strain expresses a purple light-sensitive optogenetic protein system (i.e., GUR-3 and PRDX-2) in each neuron, and GFP in coelomocytes. GCaMP6s transgene allows for imaging whole-brain calcium activity with neuronal identification using NeuroPAL system. See description of strain OH15262 for full description of otIs669 NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene (Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642). Derived by out-crossing parental strain OH15262 an additional six times before incorporating other transgenes. References: Yu X, et al. Elife. 2021 Jul 14;10:e66410. doi: 10.7554/eLife.66410. PMID: 34259623. Randi F, et al. Nature 2023 Nov;623(7986):406-414. doi: 10.1038/s41586-023-06683-4. PMID: 37914938. Sharma AK, et al. Genetics 2024 May 11:iyae077. doi: 10.1093/genetics/iyae077 PMID: 38733622.
AML508 C. elegans unc-31(wtf502) IV; otIs669 V; wtfIs145; wtfIs348. Show Description
wtfIs145 [rab-3p::his-24::GCaMP6s::unc-54 3' UTR + pBX]. wtfIs348 [pAS3-5xQUAS::(delta)pes-10p::AI::gur-3G::unc-54 3' UTR + pAS3-5xQUAS::(delta)pes-10p::AI::prdx-2G::unc-54 3' UTR + pAS3-rab-3p::AI::QF+GR::unc-54 3' UTR + unc-122::GFP]. Keep plates covered to avoid unnecessary exposure to light. This strain expresses a purple light-sensitive optogenetic protein system (i.e., GUR-3 and PRDX-2) in each neuron, and GFP in coelomocytes. GCaMP6s transgene allows for imaging whole-brain calcium activity with neuronal identification using NeuroPAL system. unc-31(wtf502) is a CRISPR-engineered deletion allele. See description of strain OH15262 for full description of otIs669 NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene (Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642). Derived by out-crossing parental strain OH15262 an additional six times before incorporating other transgenes. Reference: Randi F, et al. Nature 2023 Nov;623(7986):406-414. doi: 10.1038/s41586-023-06683-4. PMID: 37914938.
AML532 C. elegans wtfEx475. Show Description
wtfEx475 [rab-3p::AI::gur-3G::SL2::tagBFP::unc-54 3'UTR + unc-122p::GFP]. Pick animals with GFP+ coelomocytes to maintain. Keep plates covered to avoid unnecessary exposure to light. Pan-neuronal expression of a purple light-sensitive optogenetic protein GUR-3 and nuclear-localized blue fluorescent protein tagBFP. Worms expressing a purple light-sensitive optogenetic protein system: pan-neuronal expression of GUR-3 and PRDX-2. Reporter construct contains an artificial intron (AI). Reference: Sharma AK, et al. Genetics 2024 May 11:iyae077. doi: 10.1093/genetics/iyae077 PMID: 38733622.
AML546 C. elegans wtfEx496. Show Description
wtfEx496 [pAS3-rig-3p::AI::gur-3G::SL2::tagRFP::unc-54 3'UTR + pAS3-rig-3p::AI::prdx-2G::SL2::tagBFP::unc-54 3'UTR]. Pick animals either BFP or RFP expression in head neurons to maintain. Keep plates covered to avoid unnecessary exposure to light. This strain expresses a purple light-sensitive optogenetic protein system (i.e., GUR-3 and PRDX-2) alongside fluorescent proteins tagBFP and tagRFP in command interneurons AVA, and nearby pharyngeal neurons I1, I4, M4, NSM using rig-3 promoter. Worms exhibit higher reversal rate on exposing to blue light (peak value ~470) compared to controls. Reference: Randi F, et al. Nature 2023 Nov;623(7986):406-414. doi: 10.1038/s41586-023-06683-4. PMID: 37914938.
AML551 C. elegans gur-3(ok2245) X; wtfIs5. Show Description
wtfIs5 [rab-3p::NLS::GCaMP6s + rab-3p::NLS::tagRFP]. Integrated calcium indicator GCaMP6s and calcium-insensitive fluorescent protein RFP in the nuclei of all neurons in a gur-3(ok2245) mutant background. Derived from parental strain AML14 by integration of wtfEx4. Reference: Gauthey W, et al. Curr Biol. 2024 Jan 8;34(1):R14-R15. doi: 10.1016/j.cub.2023.10.043. PMID: 38194919.
AML554 C. elegans lite-1(ce314) gur-3(ok2245) X; wtfIs5. Show Description
wtfIs5 [rab-3p::NLS::GCaMP6s + rab-3p::NLS::tagRFP]. Integrated calcium indicator GCaMP6s and calcium-insensitive fluorescent protein RFP in the nuclei of all neurons in a lite-1(ce314) gur-3(ok2245) double mutant background. Derived from parental strain AML14 by integration of wtfEx4. Reference: Gauthey W, et al. Curr Biol. 2024 Jan 8;34(1):R14-R15. doi: 10.1016/j.cub.2023.10.043. PMID: 38194919.
AMP101 C. elegans weSi174 II; daf-2(syb1177[daf-2::AID*::TEV::3xFLAG]) III. Show Description
weSi174 [eif-3.Bp::TIR1::linker::mCherry(dpiRNA)::tbb-2 3'UTR + unc-119(+)] II. Auxin-inducible degradation of DAF-2::AID* causes dauer formation. Reference: Eder M, et al. Cell. 2024 Jul 25;187(15):3919-3935.e19. doi: 10.1016/j.cell.2024.05.050. PMID: 38908368.
AMP116 C. elegans weSi174 II; daf-2(syb1177[daf-2::AID*::TEV::3xFLAG]) glp-1(e2141) III. Show Description
weSi174 [eif-3.Bp::TIR1::linker::mCherry(dpiRNA)::tbb-2 3'UTR + unc-119(+)] II. Maintain at 20C or less. Sterile at 25C. Auxin-inducible degradation of DAF-2::AID* causes dauer formation. Reference: Eder M, et al. Cell. 2024 Jul 25;187(15):3919-3935.e19. doi: 10.1016/j.cell.2024.05.050. PMID: 38908368.
AMP267 C. elegans ohmSi53. Show Description
ohmSi53 [eft-3p::nTIR1::SL2::NLS::mTagBFP2::eft-3 3'UTR] IV. Pan-somatic expression of a new TIR1 (nTIR1) transgene with nuclear-localized mTagBFP2 co-expression marker. Generated by CRISPR/Cas9 modification of ohmSi49 in parental strain AMP245. ohmSi53 previously referred to as ohm53. Reference: Vicencio J, et al. Nature Communications (2025).
ANR153 C. elegans rde-1(ne300) V.; neIs9 X; pkIs2386. Show Description
pkIs2386 [unc-54p::alphasynuclein::YFP + unc-119(+)]. neIs9 [myo-3::HA::rde-1 + rol-6(su1006)] X. Rollers. YFP expression in the muscles. Derived by crossing parental strains NL5901 and WM118 to produce a Parkinson's model with muscle-only RNAi. Reference: Snow S, et al. (2024). Neuronal CBP-1 is required for enhanced body muscle proteostasis in response to reduced translation downstream of mTOR. Frontiers in Bioscience-Landmark.
ARM101 C. elegans wamSi101 V; unc-119(ed3) III. Show Description
wamSi101 [eft-3p::mTFP::unc-54 3'UTR + Cbr-unc-119(+)] V. Expresses a single copy of mTFP from eft-3 promoter; construct utilizes the unc-54 terminator and 3'UTR. Can be used as a standard for multicolor imaging and quantitative microscopy. Reference: Sands B, et al. 2018. Translational Medicine of Aging Volume 2, January 2018, Pages 1–10.
ARM103 C. elegans unc-119(ed3) III; wamSi103 V. Show Description
wamSi103 [eft-3p::mKO2::unc-54 3'UTR + Cbr-unc-119(+)] V. Expresses a single copy of mKO2 from eft-3 promoter; construct utilizes the unc-54 terminator and 3'UTR. Can be used as a standard for multicolor imaging and quantitative microscopy. Reference: Sands B, et al. 2018. Translational Medicine of Aging Volume 2, January 2018, Pages 1–10.
ARM112 C. elegans wamSi112 II; unc-119(ed3) III Show Description
wamSi112 [eft-3p::mScarlet::unc-54 3'UTR + Cbr-unc-119(+)] II. Expresses a single copy of mScarlet from eft-3 promoter; construct utilizes the unc-54 terminator and 3'UTR. Can be used as a standard for multicolor imaging and quantitative microscopy. Reference: Sands B, et al. 2018. Translational Medicine of Aging Volume 2, January 2018, Pages 1–10.
ARM118 C. elegans wamSi118 II; unc-119(ed3) III. Show Description
wamSi118 [eft-3p::mCerulean3::unc-54 3'UTR + Cbr-unc-119(+)] II. Expresses a single copy of mCerulean3 from eft-3 promoter; construct utilizes the unc-54 terminator and 3'UTR. Can be used as a standard for multicolor imaging and quantitative microscopy. Reference: Sands B, et al. 2018. Translational Medicine of Aging Volume 2, January 2018, Pages 1–10.
ARM123 C. elegans unc-119(ed3) III; wamSi123 V. Show Description
wamSi123 [eft-3p::mECitrine::unc-54 3'UTR + Cbr-unc-119 (+)] V. Expresses a single copy of mECitrine from eft-3 promoter; construct utilizes the unc-54 terminator and 3'UTR. Can be used as a standard for multicolor imaging and quantitative microscopy. Reference: Sands B, et al. 2018. Translational Medicine of Aging Volume 2, January 2018, Pages 1–10.
ARM3 C. elegans wamSi3 II; unc-119(ed3) III. Show Description
wamSi3 [eft-3p::mNeptune::unc-54 3'UTR + Cbr-unc-119(+)] II. Expresses a single copy of mNeptune from eft-3 promoter; construct utilizes the unc-54 terminator and 3'UTR. Can be used as a standard for multicolor imaging and quantitative microscopy. Reference: Sands B, et al. 2018. Translational Medicine of Aging Volume 2, January 2018, Pages 1–10.
ARM6 C. elegans wamSi6 II; unc-119(ed3) III. Show Description
wamSi6 [eft-3p::mTagBFP2::unc-54 3'UTR + Cbr-unc-119(+)] II. Expresses a single copy of mTagBFP2 from eft-3 promoter; construct utilizes the unc-54 terminator and 3'UTR. Can be used as a standard for multicolor imaging and quantitative microscopy. Reference: Sands B, et al. 2018. Translational Medicine of Aging Volume 2, January 2018, Pages 1–10.
ARM7 C. elegans wamSi7 II; unc-119(ed3) III. Show Description
wamSi7 [eft-3p::mTagRFP-T::unc-54 3'UTR + Cbr-unc-119(+)] II. Expresses a single copy of mTagRFP-T from eft-3 promoter; construct utilizes the unc-54 terminator and 3'UTR. Can be used as a standard for multicolor imaging and quantitative microscopy. Reference: Sands B, et al. 2018. Translational Medicine of Aging Volume 2, January 2018, Pages 1–10.
AT10 C. elegans srf-3(yj10) IV. Show Description
Superficially wild-type. Antibody staining required to observe phenotype. Contains at least one extraneous mutation in the background (Eur. Worm Mtg 2006, Venuz et al.).
ATD1 C. elegans unc-119(ed3) III; sqt-3(sc8) par-1(b274) V/nT1[unc-?(n754) let-?] (IV;V); zuIs45 V. Show Description
zuIs45 [nmy-2p::nmy-2::GFP + unc-119(+)] V. Balanced heterozygotes are Unc and segregate Unc (heterozygotes), Rol Par (sqt-3 par-1 homozygotes; maternal effect lethal), and dead eggs (nT1 homozygotes). NMY-2::GFP is expressed in the germline and somatic gonad. Cross of JJ1473 and KK288. Unknown if unc-119(ed3) is still present or homozygous in background. Reference: Small LE & Dawes AT. Mol Biol Cell. 2017 Aug 1;28(16):2220-2231.
ATD3 C. elegans lon-1(e185) par-3(e2074) unc-119(ed3) III; zuIs45 V; sDp3(III;f) Show Description
zuIs45 [nmy-2p::nmy-2::GFP + unc-119(+)] V. Pick wild-type to maintain. Worms carrying the sDp3 duplication are wild-type; animals that have lost the duplication are Lon Par (maternal effect lethal). Cross of JJ1473 and KK237. Unknown if unc-119(ed3) is still present or homozygous in background. Reference: Small LE & Dawes AT. Mol Biol Cell. 2017 Aug 1;28(16):2220-2231.
AUM1054 C. elegans gsk-3(tm2223) I/hT2[bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Homozygous sterile mutation balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP sterile tm2223 homozygotes. Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Reference: Furuta T, et al. Development. 2018 May 14;145(10). pii: dev161042. doi: 10.1242/dev.161042.
AUM1811 C. elegans plk-3(viz156[plk-3::GGSGGGSGGGSG::GFP]) IV. Show Description
GFP tag with linker sequence inserted at C-terminus of endogenous plk-3 locus. Expressed primarily in both male and hermaphrodite gonad. Reference: Ortega J, et al. Sci. Adv.10,eadp0466(2024).DOI:10.1126/sciadv.adp0466 https://www.science.org/doi/10.1126/sciadv.adp0466 PMID: 39356768.
AUM1830 C. elegans sart-3(tm6688)/tmC9 [F36H1.2(tmIs1221)] IV. Show Description
Homozygous sterile deletion balanced by tmC9 [F36H1.2(tmIs1221[myo-2p::Venus])]. Heterozygotes are wild-type Venus+ in pharynx, and segregate wild-type Venus+ heterozygotes, non-Venus Sterile (tm6688 homozygotes), and Venus+ Mec Unc (tmC9 homozygotes). Pick viable fertile Venus+ animals and check for correct segregation of progeny to maintain. Reference: Furuta T & Arur S. 2023. sart-3 functions to regulate germline sex determination in C. elegans. microPublication Biology. PubMed ID: 37206989.
AUM1840 C. elegans Show Description
2x outcrossed ok2812
AUM1863 C. elegans sart-3(tm15993)/tmC9 [F36H1.2(tmIs1221)] IV. Show Description
Homozygous lethal deletion balanced by tmC9 [F36H1.2(tmIs1221[myo-2p::Venus])]. Heterozygotes are wild-type Venus+ in pharynx, and segregate wild-type Venus+ heterozygotes, non-Venus Sterile (tm15993 homozygotes), and Venus+ Mec Unc (tmC9 homozygotes). Pick viable fertile Venus+ animals and check for correct segregation of progeny to maintain. 93% of tm15993 homozygotes die before adulthood and those that escape are sterile. Reference: Furuta T & Arur S. 2023. sart-3 functions to regulate germline sex determination in C. elegans. microPublication Biology. PubMed ID: 37206989.
AUM1880 C. elegans prg-1(viz142[V5::mCherry::GSIGSLRSI::prg-1]) I; plk-3(viz172[plk-3 delta 21u-10935] viz156[plk-3::GGSGGGSGGGSG::GFP]) IV. Show Description
viz172 is a series of point mutations at that piRNA binding site in endogenously-tagged plk-3 locus. GFP tag with linker sequence inserted at C-terminus of endogenous plk-3 locus. V5 epitope and mCherry tags with a flexible linker inserted after the first 18 nt of the coding sequence of endogenous prg-1 locus. Both tagged transgenes are primarily expressed and localized in both hermaphrodite and male gonad. Eight silent mutations in 21u-10935 binding site. Original plk-3: CTCAGTCGTATCGAATATGCCCAA viz172: CTgtccCGTATCGAgTAcGCaCAg Reference: Ortega J, et al. Sci. Adv.10,eadp0466(2024).DOI:10.1126/sciadv.adp0466 https://www.science.org/doi/10.1126/sciadv.adp0466 PMID: 39356768.