More Fields
Strain Species Genotype
PS8900 C. elegans sprr-2(sy1569) X. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of sprr-2; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GAAGTTTATTGCGGCAATGCGCATGCAGAGCCAAAT Right flanking sequence: AGCTCAGCAGTTCAACAACTTGCAGAAGCATGTG inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : TGTTGAACTGCTGAGCTATT Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
RB2405 C. elegans F42D1.3(ok3290) X. Show Description
F42D1.3 Homozygous. Outer Left Sequence: tgcctctgacacaattcgac. Outer Right Sequence: aattcagttgactgccgctt. Inner Left Sequence: agtttatgggcaggtttgtga. Inner Right Sequence: ttcaaagcccaatttcaagc. Inner Primer PCR Length: 1210. Deletion size: about 300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807