More Fields
Strain Species Genotype
JT3 C. elegans aex-2(sa3) X. Show Description
Constipated. aBoc and Exp defective.
PS7837 C. elegans aex-2(sy1078) X. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of aex-2; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CGGAAACGGCTTTTATGGATTACTGCAGCGACATG Right flanking sequence: GGGAGGACTTTATGCAATGAACATCGCACTTGTCA inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : ATTACTGCAGCGACATGGGG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PHX4447 C. elegans aex-2(syb4447 [aex-2::SL2::GFP::H2B)] X. Show Description
CRISPR/Cas9 engineered tagged endogneous locus. Reference: Cros C & Hobert O. bioRxiv 2022.04.19.488792; doi: https://doi.org/10.1101/2022.04.19.488792.