More Fields
Strain Species Genotype
XA3702 C. elegans npr-2(ok419) IV; unc-80(pd48) V. Show Description
Sequence across the breakpoint i: ggccattagcagaagtacgaaaattaaaactctcagaggtggaa. unc-80(pd48) allele identified 3/2008 by Neline Kriek.
CGC72 C. elegans npr-23(umn5[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I. Show Description
Homozygous viable. Deletion of 280 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AAGGCGTCATCTGGAGAGAAGAACGAAgtg ; Right flanking sequence: CGGACACTTGTGCTTCACCAACTTGATCGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
CGC73 C. elegans npr-28(umn6[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X. Show Description
Homozygous viable. Deletion of 842 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TATTTGGTATCATTTTTCTAGCCGACTTTC ; Right flanking sequence: TGGACTTGTTTTCACTCATCCCTGTACCGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
KRA597 C. elegans pha-1(e2123) III; kasEx286. Show Description
kasEx286 [npr-29::RFP + pha-1(+)]. Maintain at 25C to select for array. RFP fused with npr-29 genomic region (-9,810 to -6,028 bp). Reference: Li Y & Kratsios P. Micropubl Biol. 2021 Sep 14;2021:10.17912/micropub.biology.000453. PMID: 34549172.
PS8177 C. elegans npr-23(sy1203) I. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of npr-23. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: GTGCTTCACCAACTTGATCGCGTTGCTCGTATTGG; right flanking sequence: TGCCGGTGATCATTCATAACGTGTTCACCGGTGTC. Inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: CGCGTTGCTCGTATTGGTGC Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS8315 C. elegans npr-29(sy1270) III. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of npr-29. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: caaATGGACTTTACGGAAAATGAAGAGGAGTACGAG right flanking sequence: CATTGGACACATATTGAACGACGAGTCCCGTTTC Inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: ATGAAGAGGAGTACGAGCAT Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS8442 C. elegans npr-26(sy1307) IV. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of npr-26. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CAGCCCGATGGGATTTTGTATTGTCCAAATCACAC right flanking sequence: TGGTGGTCCCGTCTGGGTACGCAATGTCTATCCAC inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TATTGTCCAAATCACACTGG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS8444 C. elegans npr-21(sy1309) X. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of npr-21. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CTGTGTATCCTACCTTTTTGTCTTTCTGGCCACTAT right flanking sequence: AATCGgtatgccaaggatctttgttcatattttta inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: GTCTTTCTGGCCACTATAAT Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS8450 C. elegans npr-27(sy1315) IV. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of npr-27. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: gggtgtgccttcttgATGGAGGATTTTTCCTCGA right flanking sequence: ATTTCACGACAACTTCAATTCAGAATGATAGTTATG inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TGAAGTTGTCGTGAAATTCG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
RG3216 C. elegans npr-26(ve716[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Show Description
Homozygous viable. Deletion of 5117 bp  with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ATACTTGTATCAGAATTTCCACGTGTCAGA ; Right flanking sequence: cggcgtcctggagagcccgacgccagaaat. sgRNA #1: GTTGAATCATTTTGCCATAG; sgRNA #2: ttctggtgtgtatgagtgtg. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.