More Fields
Strain Species Genotype Add
CHS1190 C. elegans srd-1(yum2136) srd-2(yum2137) srd-3(yum2138) srd-4(yum2139) srd-5(yum2140) srd-7(yum2141) srd-8(yum2142) srd-9(yum2143) II. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
CHS1054 C. elegans srd-17(yum1389) srd-18(yum1390) srd-19(yum1391) srd-20(yum1392) srd-21(yum1393) srd-32(yum1394) V. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
CHS1123 C. elegans srd-33(yum1718) srd-34(yum1719) srd-35(yum1720) V; srd-36(yum1721) srd-38(yum1722) srd-39(yum1723) X. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
CHS1196 C. elegans srd-23(yum2172) srd-25(yum2173) srd-26(yum2174) srd-27(yum2175) srd-28(yum2176) srd-29(yum2177) srd-30(yum2178) srd-31(yum2179) IV. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
OH14368 C. elegans pha-1(e2123) III; him-5(e1490) V; otEx6710. Show Description
otEx6710 [srd-32p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218.
PS9487 C. elegans srd-32(sy1785) V. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of srd-32. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CACCATATACTGTATTCTTGGCGAACACCTCTA right flanking sequence: TAACGCAGCTAGGGTATTGCATATGTTTCCTCTTAAC inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: ATACCCTAGCTGCGTTATAG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS9893 C. elegans syIs844; syIs300. Show Description
syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is GFP cGAL effector. syIs844 [srd-36p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder(NEB)]. Some worms do not express ttx-3p::RFP marker, but will consistently produce worms with transgenetic marker in next generation. cGAL driver for ASK neurons.