| CHS1149 |
C. elegans |
srh-1(yum1874) srh-2(yum1875) srh-3(yum1876) srh-4(yum1877) srh-5(yum1878) srh-7(yum1879) srh-8(yum1880) V. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404. |
|
| CHS1001 |
C. elegans |
srh-99(yum1120) srh-100(yum1121) II. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404. |
|
| CHS1002 |
C. elegans |
srh-105(yum1122) II; srh-109(yum1123) srh-111(yum1124) V. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404. |
|
| CHS1003 |
C. elegans |
srh-105(yum1122) II; srh-104(yum1126) srh-102(yum1125) srh-109(yum1123) srh-111(yum1124) V. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404. |
|
| CHS1004 |
C. elegans |
srh-141(yum1127) srh-142(yum1128) srh-145(yum1129) V. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404. |
|
| CHS1005 |
C. elegans |
srh-146(yum1130) srh-147(yum1131) srh-148(yum1132) V. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404. |
|
| CHS1006 |
C. elegans |
srh-190(yum1133) srh-192(yum1134) srh-193(yum1135) V. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404. |
|
| CHS1033 |
C. elegans |
srh-127(yum1249) srh-211(yum1250) srh-212(yum1255) srh-213(yum1256) srh-214(yum1251) srh-215(yum1252) srh-216(yum1253) srh-217(yum1254) srh-218(yum1257) srh-219(yum1258) V. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404. |
|
| CHS1150 |
C. elegans |
srh-125(yum1881) srh-269(yum1882) srh-270(yum1883) srh-271(yum1884) srh-272(yum1885) srh-274(yum1886) V. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404. |
|
| CHS1159 |
C. elegans |
srh-135(yum1941) srh-136(yum1942) srh-137(yum1943) srh-138(yum1944) srh-139(yum1945) srh-140(yum1946) srh-141(yum1947) srh-142(yum1948) srh-145(yum1949) II. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404. |
|
| CHS1163 |
C. elegans |
srh-128(yum1967) srh-129(yum1968) srh-130(yum1969) srh-131(yum1970) srh-132(yum1971) srh-133(yum1972) srh-134(yum1973) II. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404. |
|
| CHS1243 |
C. elegans |
srh-185(yum2493) srh-186(yum2494) srh-187(yum2495) srh-190(yum2496) srh-192(yum2497) srh-193(yum2498) srh-194(yum2499) srh-195(yum2500) srh-199(yum2501) srh-200(yum2502) srh-201(yum2503) srh-203(yum2504) srh-204(yum2505) srh-206(yum2506) srh-207(yum2507) srh-208(yum2508) srh-209(yum2509) V. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404. |
|
| CHS1247 |
C. elegans |
srh-10(yum2523) srh-15(yum2524) srh-16(yum2525) srh-18(yum2526) srh-17(yum2527) srh-11(yum2528) srh-20(yum2529) srh-21(yum2530) srh-22(yum2531) srh-23(yum2532) srh-19(yum2533) V. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404. |
|
| CHS1268 |
C. elegans |
srh-113(yum2683) srh-115(yum2684) srh-116(yum2685) srh-118(yum2686) srh-119(yum2687) srh-120(yum2688) srh-122(yum2689) srh-123(yum2690) srh-95(yum2691) srh-97(yum2692) srh-99(yum2693) srh-100(yum2694) srh-102(yum2695) srh-104(yum2696) srh-105(yum2697) srh-109(yum2698) srh-111(yum2699) srh-112(yum2700) V. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404. |
|
| CHS1271 |
C. elegans |
srh-166(yum2716) srh-167(yum2717) srh-169(yum2718) srh-146(yum2719) srh-147(yum2720) srh-148(yum2721) srh-149(yum2722) srh-154(yum2723) srh-159(yum2724) srh-170(yum2725) srh-171(yum2726) srh-172(yum2727) srh-173(yum2728) srh-174(yum2729) srh-177(yum2730) srh-178(yum2731) srh-179(yum2732) srh-180(yum2733) srh-181(yum2734) srh-182(yum2735) srh-183(yum2736) srh-184(yum2737) srh-308(yum2738) V. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404. |
|
| EG8849 |
C. elegans |
unc-119(ed3) III; oxTi894 V. Show Description
oxTi894 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + Cbr-unc-119(+)] V. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (V:11.54). Insertion into srh-131. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1661 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection. |
|
| NC3604 |
C. elegans |
myls13; oyIs51. Show Description
myls13 [klp-6p::GFP]. oyIs51 [srh-142::RFP]. IL2 neurons are marked with GFP. ADF neurons are marked with RFP. Derived from parental line PY3470. Can be used to isolate IL2 neurons (GFP) and ADF neurons (RFP) by FACS. Used by CeNGEN project for RNA-Seq (https://www.cengen.org/). |
|
| NFB1445 |
C. elegans |
rrf-3(pk1426) II; lite-1(ce314) X; vlcEx1292. Show Description
vlcEx1292 [srh-142p::mCherry::SL2::GCaMP3 + unc-122p::RFP]. Maintain at or below 20C; sterile at 25C. Pick animals with RFP+ coelomocytes to maintain. ADF-specific expression of GCaMP3. Reference: Maicas et al. PLOS Biology 2021; 19(7): e3001334. DOI: 10.1371/journal.pbio.3001334 |
|
| NFB1925 |
C. elegans |
vlcIs10 X. Show Description
vlcIs10 [srh-142::mCherry + elt-2::GFP] X. ADF-specific reporter. Reference: Maicas et al. PLOS Biology 2021; 19(7): e3001334. DOI: 10.1371/journal.pbio.3001334 |
|
| OH14293 |
C. elegans |
pha-1(e2123) III; him-5(e1490) V; otEx6656. Show Description
otEx6656 [srh-100p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218. |
|
| OH14295 |
C. elegans |
pha-1(e2123) III; him-5(e1490) V; otEx6658. Show Description
otEx6658 [srh-142p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218. |
|
| OH14297 |
C. elegans |
pha-1(e2123) III; him-5(e1490) V; otEx6660. Show Description
otEx6660 [srh-193p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218. |
|
| OH14299 |
C. elegans |
pha-1(e2123) III; him-5(e1490) V; otEx6662. Show Description
otEx6662 [srh-199p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218. |
|
| OH14305 |
C. elegans |
pha-1(e2123) III; him-5(e1490) V; otEx6668. Show Description
otEx6668 [srh-127p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218. |
|
| OH14884 |
C.elegans |
pha-1(e2123) III; him-5(e1490) V; otIs646. Show Description
otIs646 [srh-127p::GFP + pha-1(+)]. Robust GFP expression in ADL neurons. Reference: Masoudi N, et al. PLoS Biol. 2018 Apr 19;16(4):e2004979. |
|
| OH16265 |
C. elegans |
otEx7459. Show Description
otEx7459 [srh-18::mCherry + srh-18p::NLG1::GFP1-10 + cho-1::mCherry + cho-1p::NLG1::GFP11 + unc-122p::GFP]. ASH>AIA GRASP synaptic reporter. Please contact Oliver Hobert prior to publishing work using this strain. |
|
| OS12566 |
C. elegans |
dgs-1(ns942) IV; oyIs51 V; vap-1(ns831[vap-1::sfGFP]) X. Show Description
oyIs51 [srh-142::RFP]. ADF neurons are marked with RFP. sfGFP tag inserted at C-terminus of endogenous vap-1 locus. VAP-1::sfGFP can be used as a reporter for AMsh glia secretion. dgs-1(ns942) is a presumptive partial loss of function allele. dgs-1 loss of function causes VAP-1::sfGFP accumulation. Reference: Varandas KC, et al. Nat Commun. 2025 Jan 2;16(1):79. doi: 10.1038/s41467-024-55674-0. PMID: 39747235. |
|
| OS12876 |
C. elegans |
dgs-1(ns984) IV; vap-1(ns831[vap-1::sfGFP]) X; oyIs51. Show Description
oyIs51 [srh-142::RFP]. ADF neurons are marked with RFP. sfGFP tag inserted at C-terminus of endogenous vap-1 locus. VAP-1::sfGFP can be used as a reporter for AMsh glia secretion. dgs-1 loss of function causes VAP-1::sfGFP accumulation. Reference: Varandas KC, et al. Nat Commun. 2025 Jan 2;16(1):79. doi: 10.1038/s41467-024-55674-0. PMID: 39747235. |
|
| PHX6983 |
C. elegans |
fig-1(syb6983) V; vap-1(ns831[vap-1::sfGFP]) X; oyIs51. Show Description
oyIs51 [srh-142::RFP]. ADF neurons are marked with RFP. sfGFP tag inserted at C-terminus of endogenous vap-1 locus. VAP-1::sfGFP can be used as a reporter for AMsh glia secretion. fig-1(syb6983) is an engineered deletion removing teh fig-1 coding sequence. fig-1 loss of function causes VAP-1::sfGFP accumulation and dye filling defects. Reference: Varandas KC, et al. Nat Commun. 2025 Jan 2;16(1):79. doi: 10.1038/s41467-024-55674-0. PMID: 39747235. |
|
| PS8461 |
C. elegans |
syIs591; syIs300. Show Description
syIs591 [srh-142p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)]. cGAL driver for ADF neuron. syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector. Some worms do not express ttx-3p::RFP marker, but will consistently produce worms with the transgenic marker in next generation. |
|
| RB2259 |
C. elegans |
srh-16(ok3060) V. Show Description
F55C5.9 Homozygous. Outer Left Sequence: gcaggaaatgcattgtcaaa. Outer Right Sequence: cttcaagatgagccccaaaa. Inner Left Sequence: tctgattgtgataatcgccc. Inner Right Sequence: tccgtgaacgaatgtctgaa. Inner Primer PCR Length: 1173. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
|
| RB2616 |
C. elegans |
srh-174(ok3641) V. Show Description
F40D4.1 Homozygous. Outer Left Sequence: gcaattcattccgctctttc. Outer Right Sequence: tagtcgagcacatgagtggc. Inner Left Sequence: cggacagcagaagctcactt. Inner Right Sequence: acgatacggtgtatgcacga. Inner Primer PCR Length: 1133. Estimated Deletion Size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
|
| RG3384 |
C. elegans |
plc-3 & srh-135(ve884[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mIn1 [dpy-10(e128) umnIs43] II. Show Description
umnIs43 [myo-2p::mKate2 + NeoR, II: 11755713 (intergenic)] II. Homozygous Ste. Deletion of 6,190 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 sterile adults (ve884 homozygotes), and Dpy non-GFP mKate2+ (mIn1 homozygotes). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: CTCACTTGGCCCATCATCGTCGTCTCGAAA; Right flanking sequence: TTTTGGAGCATTTTTTATAGTTTAAGTTTA. plc-3_srh-135 sgRNA A: GACTACAGTAACCAGCACAG; plc-3_srh-135 sgRNA B: TTTTGTGGCAAAAAACAGAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
|
| VC1432 |
C. elegans |
srh-159(ok1928) V. Show Description
F40D4.3. Superficially wild type. External left primer: CAAGCAGAATACACTGCGGA. External right primer: GGCAAATGTAGGACTGGCAT. Internal left primer: AAGTCCGATACGGGACTGTG. Internal right primer: CGGATGCCTTTTGTAGGTGT. Internal WT amplicon: 2230 bp. Deletion size: 954 bp. Deletion left flank: GTGATAGCTGCTACACAAAATGCACCTGCT. Deletion right flank: CAAAAGTACACCCATTTCTAGAAGCACAAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
|
| VC2340 |
C. elegans |
W02D9.3(gk1128) I; rbf-1(gk3217) III; srh-145(gk3218) V. Show Description
This strain is homozygous for a deletion (gk1128) in W02D9.3, detectable by PCR using the following primers. External left primer: ACGGATTTTGCCACTTTGTC. External right primer: CATCACATTTCTCGTGGTGG. Internal left primer: TTGGAGAGGTGTGAACGTAGAA. Internal right primer: TTTCTAGGCCGTACGTTGCT. Internal WT amplicon: 1621 bp. Deletion size: 1315 bp. Note: internal left primer binding site deleted in gk1128; major deletion product from nested PCR runs at about 650 bp. Deletion left flank: GCAGAAAAAATTTTGGAATTTGAGCTACAT. Deletion right flank: CATTTTCTTGCAGAAAAACGTGCAAAATTC. Validation: gk1128 passed by CGH. Other deletions (gk3217, gk3218) identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
|