Strain Information
Name | QC158 View On Wormbase |
---|---|
Species | C. elegans |
Genotype | paqr-1(et52) IV. |
Description | paqr-1 gain-of-function allele. R109C amino acid substitution isolated in a paqr-2(tm3410) suppressor screen. PCR genotyping can be done with these primers: paqr-1 seq REV: TTTCCGTGTGCAGTGACCA; paqr1_WT_REV: TGCCCTCCCTTTTTACGGCG; paqr1_mut_REV: TGCCCTCCCTTTTTACGGCA. This yields a 441 bp product. Reference: Busayavalasa K, et al. PLoS Genet. 2020 Aug 4;16(8):e1008975. PMID: 32750056 |
Mutagen | EMS |
Outcrossed | x10 |
Made by | Kiran Busayavalasa |
Laboratory | QC |
Reference | Busayavalasa K, et al. PLoS Genet. 2020 Aug 4;16(8):e1008975. PMID: 32750056 |
Sign in
or
register an account if you want to order this strain.