Search Strains

More Fields
Strain Species Genotype Add
RB1045 C. elegans pgp-10(ok991) X. Show Description
C54D1.1. Homozygous. Outer Left Sequence: AGCTCTTCACTTCCGCGATA. Outer Right Sequence: GTGGCGTTGTACATTCGTTG. Inner Left Sequence: TGGTAGTGGAAAAAGCACCC. Inner Right Sequence: ACCCGGAAGGTCCTACAAGT. Inner Primer WT PCR product: 3218. Deletion size: 2060 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1046 C. elegans elo-9(ok993) II. Show Description
Y53F4B.2. Homozygous. Outer Left Sequence: GAATGAGGCGTAGATTCCGA. Outer Right Sequence: ATTTTCAGCATGCGACCTCT. Inner Left Sequence: TTGTTGGCACATCTGGAAAA. Inner Right Sequence: TCTCACGAAAAACCAGGTGA. Inner Primer WT PCR Product: 3162. Deletion size: 1227 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1047 C. elegans pgp-7&pgp-6(ok994) X. Show Description
T21E8.2&T21E8.1. Homozygous. Outer Left Sequence: GCTGCAGATCCAGCCATATT. Outer Right Sequence: AAGTGACAACAGCAAACCCC. Inner Left Sequence: AGCACCCTGAACGATATTGG. Inner Right Sequence: ACGTTGGAGACAACACGACA. Inner Primer WT PCR product: 3265. Deletion size: 8345 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1048 C. elegans gcy-32(ok995) V. Show Description
C06B3.8. Homozygous. Outer Left Sequence: CCTAACAACGAACACGGCTT. Outer Right Sequence: GCATTCGGCAATTGGTTATT. Inner Left Sequence: ACACGCACCAATCAACTGAA. Inner Right Sequence: GCGAAGATACGTGGACACAA. Inner Primer WT PCR Product: 3151. Deletion size: 1988 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1049 C. elegans rom-2(ok996) III. Show Description
C48B4.2. Homozygous. Outer Left Sequence: CCCATCGAGAGAATTGGAAA. Outer Right Sequence: ATGCGTGAAGGAAAACCTGT. Inner Left Sequence: CGGAGATGAACAGAGCACAA. Inner Right Sequence: CAGATGAGCAAATGCAAAGG. Inner Primer WT PCR product: 2823. Deletion size: 530 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1050 C. elegans F15C11.2(ok997) I. Show Description
F15C11.2a. Homozygous. Outer Left Sequence: AGCTGCTCTTGAACGGTTGT. Outer Right Sequence: TGAATAAAAGGGGAACGTCG. Inner Left Sequence: CAGGAGCCCTTGCTCAATAG. Inner Right Sequence: GCTTATTAAAGGGGCCGAAG. Inner Primer WT PCR product: 2991. Deletion size: 1147 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1052 C. elegans trpa-1(ok999) IV. Show Description
C29E6.2. Homozygous. Outer Left Sequence: TCGGCTCTCTTTTCCTGTGT. Outer Right Sequence: GGTACACCGAAGTGCCATCT. Inner Left Sequence: GCTGGAATTGGAAGGATTGA. Inner Right Sequence: TCGTGACACTACCATTCCCA. Inner Primer WT PCR Product: 3280. Deletion size: 1334 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1053 C. elegans R05F9.10(ok1000) II. Show Description
R05F9.10, R05F9.1b. Homozygous. Outer Left Sequence: TTGTAAGGGGAAATTCTGCG. Outer Right Sequence: TGACGAGGGACACACAAAAA. Inner Left Sequence: AGGAGATTGGCGGAAGAGAT. Inner Right Sequence: AGTCGCAGGTTTAGCTCCAA. Inner Primer WT PCR Product: 3317. Deletion size: 2275 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1054 C. elegans ndx-4(ok1003) I. Show Description
Y37H9A.6. Homozygous. Outer Left Sequence: CATATTGCCCAGAAATGGCT. Outer Right Sequence: CCGAGAAGCTTTTGCTCTGT. Inner Left Sequence: AGTGGCAAAAATGGCAAAAA. Inner Right Sequence: GATTTGAAGCCCAAAGAGCA. Inner Primer WT PCR Product: 2133. Deletion size: 785 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1055 C. elegans R57.1(ok1004) X. Show Description
R57.1. Homozygous. Outer Left Sequence: GACCCCAACCAATATCATGC. Outer Right Sequence: TGGATACGTGTCCCATGTTG. Inner Left Sequence: CGTTTCGGTTTCAAAGTGGT. Inner Right Sequence: TGAAGTTGATCACCGGAACA. Inner Primer WT PCR Product: 2805. Deletion size: 1523 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1056 C. elegans cec-1(ok1005) III. Show Description
ZK1236.2. Homozygous. Outer Left Sequence: AATTGTAGAACCATGGCCGA. Outer Right Sequence: AACATGTGCAACAATTCCGA. Inner Left Sequence: CGTTCGGTTTGAGATGGATT. Inner Right Sequence: AGATGAGAGGCGCAGACATT. Inner Primer WT PCR Product: 2703. Deletion size: 2221 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1057 C. elegans C10G8.8(ok1006) V. Show Description
C10G8.8. Homozygous. Outer Left Sequence: ACCACTTTTTCACGGACCAG. Outer Right Sequence: GCCATCACCCTCTCTTTTCA. Inner Left Sequence: CTTCTCAACTCGCTCCATCC. Inner Right Sequence: CTCATTCGGGAAAAGAACCA. Inner Primer WT PCR Product: 3004. Deletion size: 1524 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1058 C. elegans F02E11.1(ok1007) II. Show Description
F02E11.1. Homozygous. Outer Left Sequence: ATGGTAGCGAGAAGGGAAGG. Outer Right Sequence: CGAAAAGAACGGGAAAATCA. Inner Left Sequence: CAGGAAGGAGGTGATCAGGA. Inner Right Sequence: TGACACGAATCTTCAAAGCG. Inner Primer WT PCR Product: 2485. Deletion size: 2082 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1059 C. elegans nhr-3(ok1008) X. Show Description
H01A20.1. Homozygous. Outer Left Sequence: CCCTGTATTCCTCGCATTGT. Outer Right Sequence: GGACAAACACGAGACCGAGT. Inner Left Sequence: TTGATGGCCTGTCATCTGAA. Inner Right Sequence: CCCGTCACAATGAAACACTG. Inner Primer WT PCR Product: 3070. Deletion size: 1296 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1060 C. elegans R07E5.15&R07E5.17(ok1009) III. Show Description
R07E5.15, R07E5.17. Homozygous. Outer Left Sequence: TCACGGTCATCGATTGGTTA. Outer Right Sequence: TGGCCCGGTATCACAATAAT. Inner Left Sequence: CTTGAAAAGCAACTCGGACC. Inner Right Sequence: CGGAAAATTCGACCAGAGAA. Inner Primer WT PCR Product: 2236. Deletion size: 992 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1061 C. elegans tnt-3(ok1011) X. Show Description
C14F5.3 Homozygous. Outer Left Sequence: AGCGGGATCAATTCCTTTCT. Outer Right Sequence: TATGCAACGTCTTTTGGCAG. Inner Left Sequence: CGGATGCGTTTGGTATTTCT. Inner Right Sequence: TCATTCGGGAGGAACGATAC. Inner Primer PCR Length: 3234. Estimated Deletion Size: about 1400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1062 C. elegans cpz-2(ok1012) V. Show Description
M04G12.3 Homozygous. Outer Left Sequence: GAGCTACCGCTCCACTTTTG. Outer Right Sequence: CGAGCAACTTGAAACGATGA. Inner Left Sequence: AAGTTTTCAGCTTCTGGGCA. Inner Right Sequence: TGAGCCATGCGAGTATGAAG. Inner Primer PCR Length: 3062. Estimated Deletion Size: about 1600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1063 C. elegans fut-3(ok1013) II. Show Description
F59E12.13 Homozygous. Outer Left Sequence: GAAAGTTCCAATGGGCTCAA. Outer Right Sequence: TCAACATTTTGAGCAGACGC. Inner Left Sequence: TCGTTGTCAAACCATTTCCA. Inner Right Sequence: TTGAAACCGCCAAGTGATTT. Inner Primer PCR Length: 3345. Estimated Deletion Size: about 1300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1064 C. elegans T28B8.5(ok1014) I. Show Description
T28B8.5 Homozygous. Outer Left Sequence: TGTGCTAGCTTTCCAAACCC. Outer Right Sequence: GATGGGTGTATTTTGGACCG. Inner Left Sequence: CCTGGAAGGCATTTTTGTGT. Inner Right Sequence: TTCACGGATTTTTCGTGTTG. Inner Primer PCR Length: 3066. Estimated Deletion Size: about 900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1066 C. elegans Y52B11A.4(ok1023) I. Show Description
Y52B11A.4 Homozygous. Outer Left Sequence: ATAGGCGGAGCTTAAACGGT. Outer Right Sequence: CTGATTTTTCCAGAGTCCGC. Inner Left Sequence: CGTCGCCAATTTTTGAATTT. Inner Right Sequence: TGGTGACTCATTCCGTCGTA. Inner Primer PCR Length: 2468. Estimated Deletion Size: about 1400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1067 C. elegans his-24(ok1024) X. Show Description
M163.3 Homozygous. Outer Left Sequence: GAGGACTCGCACAGTCATCA. Outer Right Sequence: TTCATTTGAGCAATTGAGCG. Inner Left Sequence: TTTCAAGTGTCACCCAACCA. Inner Right Sequence: CCATCCGTGCAAAGTTTCTT. Inner Primer PCR Length: 2807. Estimated Deletion Size: about 2500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1068 C. elegans T28F3.1(ok1025) IV. Show Description
T28F3.1 Homozygous. Outer Left Sequence: ACAAGGAATTGGCGGAATTT. Outer Right Sequence: TTGAACGCTAAACAACACGC. Inner Left Sequence: TAGGCGGTGCAGAAGCTATT. Inner Right Sequence: GGAGCATCGTTGTTTCGTTT. Inner Primer PCR Length: 3197. Estimated Deletion Size: about 2000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1069 C. elegans gly-12(ok1026) X. Show Description
F48E3.1 Homozygous. Outer Left Sequence: TTTCATCTCTGGTTCTCGGG. Outer Right Sequence: GGTCGGAGTTTGCACATTTT. Inner Left Sequence: CTAGCCGCATTCTTCTTTGG. Inner Right Sequence: TCCAATCGTTTCTTCCATCC. Inner Primer PCR Length: 2828. Estimated Deletion Size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1070 C. elegans mrp-6(ok1027) X. Show Description
F20B6.3 Homozygous. Outer Left Sequence: GTTGCGAACCTAGGCATTGT. Outer Right Sequence: TCGGAAATGGATCTCTGGAC. Inner Left Sequence: TCTGGATGCAAGCATCTGTC. Inner Right Sequence: CGCCACCATCTCCAGTAAAT. Inner Primer PCR Length: 3296. Estimated Deletion Size: about 1200 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1071 C. elegans F14F3.3(ok1028) X. Show Description
F14F3.3 Homozygous. Outer Left Sequence: GGAGCGAGAAAATGGTTTTG. Outer Right Sequence: GCAGTCATCGCATTCCTTTT. Inner Left Sequence: GATGCAAAGGGCGAAAATAA. Inner Right Sequence: TAGTAATGCGTCCGCAAACA. Inner Primer PCR Length: 2829. Estimated Deletion Size: about 1000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1072 C. elegans sod-2(ok1030) I. Show Description
F10D11.1 Homozygous. Outer Left Sequence: ACTGCTCGACAGACTCCGAT. Outer Right Sequence: GACGCATTCACCAACAAATG. Inner Left Sequence: TCGAGGCTGGAACTTCAACT. Inner Right Sequence: CCCCTAATAACTGCACCGAA. Inner Primer PCR Length: 2320. Estimated Deletion Size: about 900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1073 C. elegans dgk-4(ok1031) IV. Show Description
F42A9.1a Homozygous. Outer Left Sequence: CACCAACTCCTGGAGCAACT. Outer Right Sequence: AATCTCATGACTGGGGCAAG. Inner Left Sequence: TGAGCCATCGACTGCTTATG. Inner Right Sequence: CGGCGTTGGTAGTTTTCAGT. Inner Primer PCR Length: 3388. Estimated Deletion Size: about 2000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1074 C. elegans smf-3(ok1035) IV. Show Description
Y69A2AR.4 Homozygous. Outer Left Sequence: TTCAGCTTGTCAAGGGCTTT. Outer Right Sequence: CTTCCATTGGGGAAGTTTGA. Inner Left Sequence: CCCAAAGTGATCGGAACCTA. Inner Right Sequence: GGGATTATTTGGACCCGACT. Inner Primer PCR Length: 2195. Estimated Deletion Size: about 1800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1075 C. elegans pes-9(ok1037) V. Show Description
R11H6.1 Homozygous. Outer Left Sequence: CTTCGATGAGACAGCCACAA. Outer Right Sequence: TTACTGGAAGTTTCCCCGTG. Inner Left Sequence: CAACGGCAACAAGATTAGGG. Inner Right Sequence: GTGAAGCAGTGGCAATTCAA. Inner Primer PCR Length: 2301. Estimated Deletion Size: about 1300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1077 C. elegans rgs-10(ok1039) X. Show Description
F45B8.2 Homozygous. Outer Left Sequence: AAACCACAGGGTCTGACAGG. Outer Right Sequence: CTTGCGCGACATCAAAAGTA. Inner Left Sequence: GGCATGTTCACTCGGAATTT. Inner Right Sequence: CGTTTGTGCAGAGTGAAGGA. Inner Primer PCR Length: 2185. Estimated Deletion Size: about 1000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1078 C. elegans T10G3.5(ok1040) V. Show Description
T10G3.5 Homozygous. Outer Left Sequence: GCTTCCAATTCTCTTGCTCG. Outer Right Sequence: ATTTAAGCGGAACAGCCTCA. Inner Left Sequence: TGAACTGCGTCTTCAATTCG. Inner Right Sequence: GAAATCAGAGGGAATCCGGT. Inner Primer PCR Length: 2757. Estimated Deletion Size: about 1300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1079 C. elegans alg-4(ok1041) III. Show Description
ZK757.3 Homozygous. Outer Left Sequence: GGATTTGGTCCGAAGTAGCA. Outer Right Sequence: GCCGATGATCAAGGATCTGT. Inner Left Sequence: GAGTTGGAATGGAGACCGAA. Inner Right Sequence: CAATATGCGTGAGGTGGTTG. Inner Primer PCR Length: 2888. Estimated Deletion Size: about 1200 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1080 C. elegans haf-4(ok1042) I. Show Description
W04C9.1. Homozygous. Outer Left Sequence: AGTCCTTGGGTCTCACAACG. Outer Right Sequence: ACGATTTGTTCCTGCCAATC. Inner Left Sequence: CCGTGAAAAAGTACGCGTTT. Inner Right Sequence: GCACTCTAAACACTTCCGGC. Inner Primer PCR Length: 2570 bp. Deletion Size: 1678 bp. Deletion left flank: ACACGGGACAAGTCATCGCTACCGTGGTCG. Deletion right flank: GCGTCAATTTCGGTTCGACAAATCGTTTGC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1081 C. elegans klf-2(ok1043) V. Show Description
F53F8.1 Homozygous. Outer Left Sequence: GTTACTGTTTGCCCATGCCT. Outer Right Sequence: CGTCTTGTTCATCCGTTTCA. Inner Left Sequence: GAAATGCCCAAAAGTGTCGT. Inner Right Sequence: CTCGAAAATTTCCTGGAGCA. Inner Primer PCR Length: 3195. Estimated Deletion Size: about 1500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1082 C. elegans K12G11.2(ok1048) V. Show Description
K12G11.2 Homozygous. Outer Left Sequence: TGTCAGGTGGAATACGACGA. Outer Right Sequence: ACATATTCCGAAAAGTGCCG. Inner Left Sequence: TGTTCCATTCACTTCCGTCA. Inner Right Sequence: TGCACGTACACATTCTGCAA. Inner Primer PCR Length: 2923. Estimated Deletion Size: about 1700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1083 C. elegans F27C8.5(ok1050) IV. Show Description
F27C8.5 Homozygous. Outer Left Sequence: AGATTGCGTCTGTGTGATCG. Outer Right Sequence: CTAGAGAAAGGTGCATCGGC. Inner Left Sequence: CGCGGCTTCACAAATAAAAT. Inner Right Sequence: AGAACCTCTTTTCCGGTGGT. Inner Primer PCR Length: 3168. Estimated Deletion Size: about 1100 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1084 C. elegans oct-1(ok1051) I. Show Description
F52F12.1 Homozygous. Outer Left Sequence: TATCGGAGTGTCGATGCAAG. Outer Right Sequence: CAGCCTACCTTCGTGCCTAC. Inner Left Sequence: GATTCTCGTTTCTTGGCTGC. Inner Right Sequence: GCAAGAGGCAGGCATAGTTC. Inner Primer PCR Length: 3239. Estimated Deletion Size: about 1600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1085 C. elegans tir-1(ok1052) III. Show Description
F13B10.1a Homozygous. Outer Left Sequence: GCAATCAAAGTTTCCAGCGT. Outer Right Sequence: CCTTGTCCTACTCAGCCAGC. Inner Left Sequence: AGATAAAGTCGGCAACCTGC. Inner Right Sequence: CAAATGGCGATCTGTACCCT. Inner Primer PCR Length: 3224. Estimated Deletion Size: about 1900 bp. From Nathalie Pujol 11/04: breakpoints, with a 8 bases insertion, AAATGTCGCCGGATCGTGAACTTGCAAGAAT/AGAATAAA/TGTAGACAGTGCTGGCGT AATTCGCCCA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1086 C. elegans inx-5(ok1053) X. Show Description
R09F10.4 Homozygous. Outer Left Sequence: TTGCAAGCATTATTTGCGAG. Outer Right Sequence: ATTCCATTTTCCCATCCTCC. Inner Left Sequence: GGCAGCTTGACACAATTGAA. Inner Right Sequence: TTATTGCCGGTGGTTCTGAT. Inner Primer PCR Length: 3205. Estimated Deletion Size: about 1200 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1087 C. elegans kal-1(ok1056) I. Show Description
K03D10.1 Homozygous. Outer Left Sequence: TTTTCCGGAAGATTCCAGTG. Outer Right Sequence: AAAAATGCGGGAATGTTTTG. Inner Left Sequence: GCTGAAAAATCGTGGGAAAA. Inner Right Sequence: CCCATTTTCTTTTGCAGGAA. Inner Primer PCR Length: 2786. Estimated Deletion Size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1088 C. elegans magu-2(ok1059) V. Show Description
C01B7.4 Homozygous. Outer Left Sequence: AAAGACCGGGGAGAGATGAT. Outer Right Sequence: GCATATTCTTTTTGGCGCTC. Inner Left Sequence: TAGCACGCTGTCCATGTAGC. Inner Right Sequence: TTGACTCATACGCCCAATCA. Inner Primer PCR Length: 3137. Estimated Deletion Size: about 1100 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1089 C. elegans hpl-1(ok1060) X. Show Description
K08H2.6 Homozygous. Outer Left Sequence: CCGACATAGGTTTGCACCTT. Outer Right Sequence: CGAAGTGGAATTGGTGGTCT. Inner Left Sequence: CAAGATGCTCCGTTGTTTCA. Inner Right Sequence: GGAGTCGGGAATCAGTCAGA. Inner Primer PCR Length: 2728. Upper breakpoint flanking sequence: TTCGGATTTGAAAGAGTCTGAAAAAGAT. Lower breakpoint flanking sequence: TTGAACTGTAGTCTTTGCTACTTCTT. Deletion Size: 1948 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1090 C. elegans hpl-2(ok1061) III. Show Description
K01G5.2 Homozygous. Outer Left Sequence: TTTTTACGGGCGAAATTCAG. Outer Right Sequence: AATTCAGTGATGACACGGCA. Inner Left Sequence: AATTTGTCGATGCACCATGA. Inner Right Sequence: CAGTCGGTGAGTTTGGGAAT. Inner Primer PCR Length: 2358. Estimated Deletion Size: about 1500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1091 C. elegans Y64G10A.7(ok1062) IV. Show Description
Y64G10A.7 Homozygous. Outer Left Sequence: AAAGACCGGACCACTTTGTG. Outer Right Sequence: AACTCACGTTGGACCGAATC. Inner Left Sequence: GTGCGCACACTTGTTCTTGT. Inner Right Sequence: CGATTGACATGCAATTTTCG. Inner Primer PCR Length: 3287. Estimated Deletion Size: about 2700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1092 C. elegans E02H1.2(ok1070) II. Show Description
E02H1.2 Homozygous. Outer Left Sequence: TTTTCCAAGGTGGACCAAAG. Outer Right Sequence: CTTTTCTCGACGGCTTCAAC. Inner Left Sequence: TTGCTAGGGAGCATCCAAGT. Inner Right Sequence: CCCAATACAACCAGCAACAA. Inner Primer PCR Length: 2359. Estimated Deletion Size: about 350 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1093 C. elegans C08H9.2(ok1071) II. Show Description
C08H9.2 Homozygous. Outer Left Sequence: CATCTTTTCCTGCAACGACA. Outer Right Sequence: AACATCACTTTCCGTTTGGC. Inner Left Sequence: GGATCTTCTGCTCCTTGACG. Inner Right Sequence: GGACGTCTCATTGGAAAGGA. Inner Primer PCR Length: 3020. Estimated Deletion Size: about 1200 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1094 C. elegans tag-52(ok1072) X. Show Description
C02F12.4 Homozygous. Outer Left Sequence: GCAAATACCACCACCACACA. Outer Right Sequence: TATAAACGACGGGAAAACGC. Inner Left Sequence: AAGCTCACCGCAAACTCAAT. Inner Right Sequence: ACATACAGCACGGCATTTGA. Inner Primer PCR Length: 2998. Estimated Deletion Size: about 2500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1095 C. elegans chup-1(ok1073) X. Show Description
ZK721.1 Homozygous. Outer Left Sequence: AATTTCAGGCGCTATGAGGA. Outer Right Sequence: CTTGAAATAAAAGCGCGAGG. Inner Left Sequence: TGGGATGTGGTGTACGAAAA. Inner Right Sequence: CAGGAAATGACAGCAGCAAA. Inner Primer PCR Length: 2993. Estimated Deletion Size: about 1000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1096 C. elegans R06C7.1(ok1074) I. Show Description
R06C7.1 Homozygous. Outer Left Sequence: GCTCCACCAGGAGCTATGAC. Outer Right Sequence: AAATCGAACAAAATTCCCCC. Inner Left Sequence: TGTACATGAAGCCAACCGAA. Inner Right Sequence: CGGTTTGTTTGTAGCCGATT. Inner Primer PCR Length: 2933. Estimated Deletion Size: about 1600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1097 C. elegans grl-4(ok1076) IV. Show Description
F42C5.7 Homozygous. Outer Left Sequence: AAGCCACGTAACAAAATCCG. Outer Right Sequence: AGTGATCAGAGATGGGCTGG. Inner Left Sequence: TACTGTCCAGGGGAGATTCG. Inner Right Sequence: GGCAATGTCGAGAAGGAAAC. Inner Primer PCR Length: 2926. Estimated Deletion Size: about 900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807