AV221 |
C. elegans |
unc-119(ed3) meT8 (III); meIs4 meT8 (IV); meIs1. Show Description
meIs1 [pie-1p::GFP::lacI + unc-119(+)]. meIs4 [lac-O + rol-6(su1006) + lacO] IV. Pick Rol worms to maintain. This strain throws both Rol and non-Rol worms, seemingly due to random silencing of rol-6(su1006) in the lacO array, meIs4. The strain expresses GFP::LacI in the gonad and embryos that is observed as foci (of lacO target) and nuclear haze. The expression level of GFP::LacI occasionally becomes low possibly due to random silencing of meIs1. If this happens, heat shock the strain at 25°C for 3 days, and pick a clone that exhibits bright GFP signals. Even at the highest expression level, GFP signal is too weak to detect with a fluorescent dissection microscope, and it is necessary to use a regular compound fluorescent microscope with an oil immersion 60X or 100X objective. The NA of the objective should be higher than 1.4. Reference: Bilgir C, et al. G3 (Bethesda). 2013 Mar 11. pii: g3.112.005165v1.
|
|
QC121 |
C. elegans |
nhr-49(et8) I; paqr-2(tm3410) III. Show Description
paqr-2(tm3410) homozygotes are unable to grow at 15°C and exhibit a withered tail tip phenotype at 20°C and 25°C. nhr-49(et8) is a gain-of-function allele and suppresses the cold-adaptation defect and tail-tip defects of paqr-2(tm3410) mutants. nhr-49(et8); paqr-2(tm3410) double mutants can be propagated at 15°C and have a weak tail tip defect. Reference: Svensk E, et al. PLoS Genet. 2013 Sep;9(9):e1003801.
|
|
QC155 |
C. elegans |
nhr-49(et8) I; mdt-15(et14) III. Show Description
This double mutant strain contains an excess polyunsaturated fatty acids in its cell membranes accompanied by excess lipid peroxidation, cell permeability, increased autophagy and other defects. The nhr-49(et8) C9873765T [WS200] mutation can be detected by PCR using the following primers: nhr-49 Fwd: 5-CAGATTATGATTCGTGATGCTAGA-3; nhr-49 WT Rev: 5-GAGATGAAAGATGTTGCTGTAGAG-3; nhr-49 Mut Rev: 5-GAGATGAAAGATGTTGCTGTAGAA-3. Annealing 65°C, expected products ~300 bp. The mdt-15(et14) C5832666T [WS200] mutation can be detected by PCR using the following primers: mdt-15(et14) Mut Fwd: 5-GTGCCTCCAGATCCACAGCT-3; mdt-15(et14) WT Fwd: 5-GTGCCTCCAGATCCACAGCC-3; mdt-15 Rev: 5-CACCCATTGGAGCACCACT-3. Annealing 65°C, expected product ~400 bp. Reference: Devkota R, et al. Genetics (in press). Volume 219, Issue 1, September 2021. https://doi.org/10.1093/genetics/iyab093
|
|
QC156 |
C. elegans |
acs-13(et54) nhr-49(et8) I; mdt-15(et14) III. Show Description
This triple mutant strain contains an excess polyunsaturated fatty acids in its cell membranes accompanied by excess lipid peroxidation, cell permeability, increased autophagy and other defects. The acs-13(et54) mutation (G125R) can be detected using PCR with the following primers: WT FWD: 5´CTA CCA GGG TGT TCG CCA TG 3; acs-13 mutant FWD: 5´CTA CCA GGG TGT TCG CCA TA 3; acs-13 REV: 5´TCA AAC TTG GGC ATT GCT CC 3´. Annealing 65°C, expected product 395 bp. The nhr-49(et8) C9873765T [WS200] mutation can be detected by PCR using the following primers: nhr-49 Fwd: 5-CAGATTATGATTCGTGATGCTAGA-3; nhr-49 WT Rev: 5-GAGATGAAAGATGTTGCTGTAGAG-3; nhr-49 Mut Rev: 5-GAGATGAAAGATGTTGCTGTAGAA-3. Annealing 65°C, expected products ~300 bp. The mdt-15(et14) C5832666T [WS200] mutation can be detected by PCR using the following primers: mdt-15(et14) Mut Fwd: 5-GTGCCTCCAGATCCACAGCT-3; mdt-15(et14) WT Fwd: 5-GTGCCTCCAGATCCACAGCC-3; mdt-15 Rev: 5-CACCCATTGGAGCACCACT-3. Annealing 65°C, expected product ~400 bp. Reference: Devkota R, et al. Genetics (in press). Volume 219, Issue 1, September 2021. https://doi.org/10.1093/genetics/iyab093
|
|
JCB459 |
C. elegans |
C18E9.4(bet80) II. Show Description
Homozygous viable. Deletion of 492 bp in parental strain N2. Left flanking sequence: agccgtttaagatcccaaac; Right flanking sequence: ggatggtcatcattagaatt. sgRNA #1: ttgctgtagattgagtagtt; sgRNA #2: cacggaaccacctcatggga.
|
|
JCB461 |
C. elegans |
Y116F11B.14(bet83) V. Show Description
Homozygous viable. Deletion of 1493 bp in parental strain N2. Left flanking sequence: attaatttttgaatttcctaca; Right flanking sequence: tgacgggctaatattgaatta. sgRNA #1: attacactataataatgtgt; sgRNA #2: aaacgacaaactcattatga.
|
|
JCB487 |
C. elegans |
K02D10.1(bet88) III. Show Description
Homozygous viable. Deletion of 2796 bp in parental strain N2. Left flanking sequence: tatgaactttaagaccaact; Right flanking sequence: ggatgggatgcaactgttgc. sgRNA #1: actcatactataagttcagt; sgRNA #2: ctacttgggcaaagccagga.
|
|
SV1361 |
C. elegans |
unc-119(ed3) III; heIs105 IV. Show Description
heIs105 [rps-27::loxP::NLS::mCherry::let858 UTR::loxP::NLS::GFP::let-858 UTR + unc-119(+)] IV. Strain is viable at 15-25 C. heIs105 carries a read-out construct which allows the visualization of the CRE lox mediated recombination by a switch from red to green. Reference: Ruijtenberg S & van den Heuvel S. Cell. 2015 Jul 16;162(2):300-13.
|
|
SV1440 |
C. elegans |
unc-119(ed3) III; heIs105 IV; heSi141 X. Show Description
heIs105 [rps-27::loxP::NLS::mCherry::let858 UTR::loxP::NLS::GFP::let-858 UTR + unc-119(+)] IV. heSi141 [hlh-8(short)::FLAG::CRE::tbb-2 + unc-119(+)] X. Maintain at 15-25C. Expression of CRE recombinase in the mesoblast lineage driven by the hlh-8 promoter. heIs105 carries a read-out construct which allows the visualization of the CRE lox mediated recombination in the mesoblast lineage by a switch from red to green. This read-out construct is silenced in the germline. Reference: Ruijtenberg S & van den Heuvel S. Cell. 2015 Jul 16;162(2):300-13.
|
|
SV1450 |
C. elegans |
unc-119(ed3) III; heIs145 IV Show Description
heIs145 [rps-27::loxP::NLS::mCherry::let858 UTR::eft-3::tagBFP::tbb-2 UTR::loxP::NLS::GFP::let-858 UTR + unc-119(+)] IV. Maintain at 15-25C. heIs145 expresses a read-out construct used to visualize CRE activity and specificity, and to test whether CRE expression is likely to induce loss of a gene of interest (tagBFP in this case) in a given tissue. Expression of CRE will result in a change from mCherry to GFP and loss of tagBFP expression in those cells where CRE is active. Reference: Ruijtenberg S & van den Heuvel S. Cell. 2015 Jul 16;162(2):300-13.
|
|
SV1578 |
C. elegans |
unc-119(ed3) III; heIs105 IV; swsn-1(os22) heSi164 V; heSi141 X. Show Description
heIs105 [rps-27::loxP::NLS::mCherry::let858 UTR::loxP::NLS::GFP::let-858 UTR + unc-119(+)] IV. heSi164 [rps-27::loxN::NLS::mCherry::let858 UTR::swsn-1p::swsn-1::unc-54 UTR::loxN::NLS::GFP::let-858 UTR + unc-119(+)] V. heSi141 [hlh-8(short)::FLAG::CRE::tbb-2 + unc-119(+)] X. Maintain the line at 15C and shift to 25C for mutant analysis. Expression of CRE recombinase in the mesoblast lineage driven by the hlh-8 promoter. heSi164 carries a swsn-1 rescue construct which ensures rescue of the temperature-sensitive swsn-1(os22) mutation. Upon expression of CRE (in this case in the mesoblast lineage) the swsn-1 gene will be excised, creating a mesoblast specific mutant of swsn-1. This recombination event can be visualized by a switch from red to green in those mesoblast cells in which swsn-1 was lost. The animals are healthy at 15C, but embryonic lethal and larval arrested at 23-25C. swsn-1(os22) causes mild overproliferation in the mesoblast lineage. The swsn-1 rescuing transgene is unable to rescue germline development of swsn-1(os22) mutants. Reference: Ruijtenberg S & van den Heuvel S. Cell. 2015 Jul 16;162(2):300-13.
|
|