Search Strains

vtIs1 [dat-1p::GFP + rol-6(su1006)] V. muEx261 [ceh-20::GFP + odr-1::RFP]. Pick RFP+ animals to maintain. Rollers. Embryonic lethality of ceh-20(mu290); ceh-40(gk159) double mutants is rescued by muEx261.

TI223.E1: AGACTTGAAGGAAACGCGAA. TI223.E2: AATCAAATTGAAACGGCTCG. TI223.I1: AATCCTTGCCAACCAAACAG. TI223.I2: CGTAGCATCCTTGGACCAGT. This strain was provided by the C. elegans Gene Knockout Project at OMRF, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. http://www.mutantfactory.ouhsc.edu/

Point mutation W257-> stop codon. Disrupts P cell nuclear migration at 25C. This leads to an Egl, Unc worm. P cell nuclear migration is normal at 15C. hyp7 nuclear migration is normal at all temperatures.

kuIs55 [lon-3::GFP + unc-119(+)]. Rollers. The kuIs55 lon-3::GFP transgene does not rescue the Lon phenotype of lon-3 mutants, but instead causes an adult Rol (Roller) phenotype both in lon-3 mutants and in wild-type backgrounds. Reference: Suzuki Y, et al. 2002. Genetics 162: 1631–1639.

Semi-dominant suppressor of let-60(n1046). Strong reduction of function mutation. At 20C: <1% Muv, 24% Egl, 6% larval lethal, and SM migration defects.

Double mutants displayed a severe defect in seam-cell development, implicating a retarded heterochronic phenotype. Protruding vulva phenotype. Increased number of seam cells. Reference: Zhang L, et al. Mol Cell. 2007 Nov 30;28(4):598-613. PMID: 18042455

Superficially wild-type. Identified in a screen for suppressors of the Multivulva (Muv) phenotype in lin-31 loss-of-function (lf) mutants. Reference: Ding L, et al. Mol Cell. 2005 Aug 19;19(4):437-47. PMID: 16109369.

wIs51 [SCMp::GFP + unc-119(+)] V. kuEx194 [elt-1(+) + sur-5p::DsRed]. GFP expression in seam cells. Pick DsRed+ animals to maintain. In a daf-12(WT) background, elt-1(ku491) exhibits some precocious fusion of seamcells and gaps in alae. elt-1(ku491); daf-12(rh61rh411) double mutants have more sever heterochronic phenotypes including seamcell proliferation and bursting vulvae. Reference: Cohen ML, et al. PLoS Genet. 2015 Mar 27;11(3):e1005099.

Superficially wildtype. Homozygous nprl-3(ku540) can suppress the early larval arrest phenotype of mmBCFA deficiency mutants elo-5(gk208) and cgt-1(tm1027) cgt-3(tm504). References: Zhu H, et al. Elife. 2013 May 21;2:e00429. Zhu H, Sewell AK, Han M. Genes Dev. 2015 Jun 15;29(12):1218-23.

Maintain at 15C. nmy-1(mc90) allele induces almost complete sterility at 25C. mc90 is a CRISPR-engineered mutation in nmy-1 at the position corresponding to the allele nmy-2(ne3409) changing NMY-2 Leucine-981 to Proline, which is conserved among nonmuscle myosins. mc90 was introduced in parental strain ML2540, which carries a GFP-tag in the endogenous nmy-1 locus. Reference: Molnar K, et al. Genetics. 2024 Sep 4;228(1):iyae109. doi: 10.1093/genetics/iyae109. PMID: 39053622.

Maintain at 15C. nmy-2(ne3409) allele induces embryonic lethality (cytokinesis defective) at 25C. nmy-1(mc90) allele induces almost complete sterility at 25C. mc90 is a CRISPR-engineered mutation in nmy-1 at the position corresponding to the allele nmy-2(ne3409) changing NMY-2 Leucine-981 to Proline, which is conserved among nonmuscle myosins. mc90 was introduced in parental strain ML2540, which carries a GFP-tag in the endogenous nmy-1 locus. Reference: Molnar K, et al. Genetics. 2024 Sep 4;228(1):iyae109. doi: 10.1093/genetics/iyae109. PMID: 39053622.

Heterozygotes are WT and segregate WT, embryonic lethals (embryos fail to elongate) and Sterile Uncs. mc14 identified as a mutation that leads to abnormal lin-26 expression.

Heterozygotes are WT and segregate WT, DpyUnc and dead eggs (mc1 homozygotes). mc1 is a strong loss of function mutation, but probably not null. mc1 is an embryonic lethal mutation with degeneration of hypodermal cells.

lucIs20 [mir-35p::mirtron-35 + myo-2::mCherry]. Position of integrated transgene unknown (not on X). mir-35 family mutant expressing a mirtron-version of mir-35. nDf50 nDf49 mutants are partially rescued by expression of mirtron-35 from integrated transgene; mild mir-35-related phenotypes are more severe at elevated temperatures. Strain is derived from injection into parental strain MT14533. Position of integrated transgene unknown (not on X). Reference: Dexheimer, PJ, et al. Curr Biol. 2020. in press.

luc39 is a deletion of mir-791. mir-791(luc39) mutants show a decreased turning and reversal rate compared to N2 animals under conditions where the CO2 concentration is gradually increased from 0-5%. Reference: Drexel T, et al. Genes Dev. 2016 Sep 15;30(18):2042-2047.

luc40 is a deletion of mir-790. luc40 mutants respond normally to CO2 as compared to mir-791(lf) animals. Reference: Drexel T, et al. Genes Dev. 2016 Sep 15;30(18):2042-2047.

CRISPR/Cas9-engineered deletion removes the entire dct-1 coding sequence. Homozygote mutant animals are viable and have normal morphology. Outer left sequence: gtttcagagacgggtctttcctaaca Outer right sequence: ttccaaacaaaaattttaacgttcgactta sgRNA1: ACAGCAGACGGAGCAGTCAT sgRNA2: GTACAGTGAAATGAGGTAAG Reference: Gutie?rrez-Pérez, P. et al. A deeply conserved miR-1 dependent regulon supports muscle cell physiology. bioRxiv, 2020, doi.org/10.1101/2020.08.31.275644.

Superficially wild-type. CRISPR/Cas9-engineered mir-4813 seed mutant: ttcaatat to tGCGCat (introduced FspA1 cutting site) and inserted additional PAM mutation in the upstream region.

luc28 removes mir-791 binding sites in the cah-3 3'UTR. luc28 worms show less response towards a gradual increase in CO2 concentration from 0-5% as compared to N2 animals. Reference: Drexel T, et al. Genes Dev. 2016 Sep 15;30(18):2042-2047.

lucIs24 [mir-52p::mirtron-51 + elt-2::dsRed + myo-2::mCherry]. Pick GFP+ animals to maintain balanced line. Balanced mir-51 family mutant expressing a mirtron-version of mir-51. Heterozygotes are wild-type with pharyngeal GFP signal, and segregate wild-type GFP, arrested nT1[qIs51] aneuploids, and non-GFP mir-51 family homozygous mutants. Pick wild-type GFP+ and check for correct segregation of progeny to maintain. Non-GFP mir-51 family homozygous mutants rescued by mirtron-51 transgene are viable, but slow-growing and sick. Strain is derived from injection into parental strain MT17143. lucIs24 is a spontaneous integrant originating from a complex extra-chromosomal array, the genomic location of the transgene is unknown. Reference: Dexheimer, PJ, et al. Curr Biol. 2020. in press.

Slow generation time, 6-7 days. Progeny production and survival to reproduction are reduced.

Allele-specific suppressor of unc-8(e49). lb141 single mutant animals are coiler Uncs. Both suppression of e49 and coiling are recessive.

WT. lb88 is a recessive X-linked suppressor of unc-8 dominant mutations.

Hets are WT and segregate WT, Dpys and maternally rescued clk double mutants (WT). To study clk double mutants, pick WT worms singly onto plates. Maternally rescued clk-1 clk-2 worms segregate very slow hatching and developing progeny and no Dpys. Double mutants do not give a viable strain but rather die out over a few generations.

Dorsal protrusions on head and tail. Head frequently twisted. 30% of embryos die. 86% of larvae die. 44% of adult survivors show a mutant phenotype. Full zygotic and maternal rescue.

Variably deformed with no prominent single feature. Deformed pharynx. Very severly Unc: from strongly kinky to complete paralysis. Neuroanatomical defects. Abnormal excretory system. Abnormal gonads. 32% of embyros die. 80% of larvae die. 100% of adult survivors show a mutant phenotype.

Variably deformed with no prominent single feature. Deformed pharynx. Very severly Unc: from strongly kinky to complete paralysis. Neuroanatomical defects. Abnormal excretory system. Abnormal gonads. 15% of embyros die. 26% of larvae die. 100% of adult survivors show a mutant phenotype. Full zygotic and maternal rescue.

No visible phenotype. Severely decreased levels of the RoRNP-associated CeY RNA. Higher frequency of mutant 5S rRNA molecules into rop-1 ribosomes. See also WBPaper00003694.

Variably deformed with no prominent single feature. Deformed pharynx. Very severly Unc: from strongly kinky to complete paralysis. Neuroanatomical defects. Abnormal excretory system. Abnormal gonads. 5% of embyros die. 54% of larvae die. 82% of adult survivors show a mutant phenotype.

Hets are WT and segregate WT, Dpys and maternally rescued GroClks (WT). To study gro-1 clk-2 doubles, pick WT worms singly onto plates. Maternally rescued gro-1 clk-2 worms segregate very slow hatching and developing progeny and no Dpys. Double mutants do not give a viable strain but rather die out after a few generations.

mCherry knocked into C terminal of vit-6 by CRISPR/Cas9 in the background of parental strain BCN9071 vit-2(crg9070[vit-2::gfp]) X. This resulting double-labelled strain was crossed six times with N2 to remove potential off-target mutations. mCherry and GFP are co-localized in the intestine, body cavity, oocyte, and embryo in adult hermaphrodites. Reference: Zhai C, et al. Aging cell, 21(11), e13719. https://doi.org/10.1111/acel.13719 PMID: 36199214.

mCherry knocked into C terminal of vit-3 by CRISPR/Cas9 in the background of parental strain BCN9071 vit-2(crg9070[vit-2::gfp]) X. This resulting double-labelled strain was crossed six times with N2 to remove potential off-target mutations. mCherry and GFP are co-localized in the intestine, body cavity, oocyte, and embryo in adult hermaphrodites. Reference: Zhai C, et al. Aging cell, 21(11), e13719. https://doi.org/10.1111/acel.13719 PMID: 36199214.

mCherry knocked into C terminal of vit-1 by CRISPR/Cas9 in the background of parental strain BCN9071 vit-2(crg9070[vit-2::gfp]) X. This resulting double-labelled strain was crossed six times with N2 to remove potential off-target mutations. mCherry and GFP are co-localized in the intestine, body cavity, oocyte, and embryo in adult hermaphrodites. Reference: Zhai C, et al. Aging cell, 21(11), e13719. https://doi.org/10.1111/acel.13719 PMID: 36199214.

hq532 is a CRISPR-engineered knockout of vit-1 in vit-2(ok3211) background removing 8 bp from the third exon of vit-1: WT sequence AAAGCATTGAGAAGGAGTCCACAACTGTTGTCCGCGGACGCCGTATCCAAACCGGAATCACG mutated to AAAGCATTGAGAAGGAGTCCACAAC--------GCGGACGCCGTATCCAAACCGGAATCACG. For genotyping, the following primers will produce ~800 bp DNA fragment that can be sequenced. Forward primer: TACCAACGTGTTGCTATCGTTTGCTC. Reverse primer: TTGCTCGAAGAGTGGGGTGAACATTCTC. Strain does not express vit-1 or vit-2. Reference: Zhai C, et al. bioRxiv 2022.06.27.497668; doi: https://doi.org/10.1101/2022.06.27.497668

hqIs180 [sdhb-1p::mtLS::cpYFP + rol-6(su1006)]. Rollers. About four mitoflash events per anterior pharynx per 200 seconds on adult days 2-3 when cultured on standard NGM plates at 20C. In hqIs180 mtLS is a mitochondrial localization sequence from SDHB-1 and cpYFP is circularly permuted yellow fluorescent protein, a superoxide sensor (Wang W. et al., Cell, 2008). The cpYFP signal is detected in most or all tissues, but most strongly in the pharyngeal muscles. Reference: Shen E-Z, et al. Nature. 2014 Feb 12. doi: 10.1038/nature13012.

hqIs180 [sdhb-1p::mtLS::cpYFP + rol-6(su1006)]. Rollers. About two mitoflash events per anterior pharynx per 200 seconds on adult day 3 when cultured on standard NGM plates at 20 ºC. In hqIs180, mtLS is a mitochondrial localization sequence from SDHB-1 and cpYFP is circularly permuted yellow fluorescent protein, a superoxide sensor (Wang W. et al., Cell, 2008). The cpYFP signal is detected in most or all tissues, but most strongly in the pharyngeal muscles. Reference: Shen E-Z, et al. Nature. 2014 Feb 12. doi: 10.1038/nature13012.

hqIs180 [sdhb-1p::mtLS::cpYFP + rol-6(su1006)]. Rollers. About three mitoflash events per anterior pharynx per 200 seconds on adult day 3 when cultured on standard NGM plates at 20 ºC. In hqIs180, mtLS is a mitochondrial localization sequence from SDHB-1 and cpYFP is circularly permuted yellow fluorescent protein, a superoxide sensor (Wang W. et al., Cell, 2008). The cpYFP signal is detected in most or all tissues, but most strongly in the pharyngeal muscles. Reference: Shen E-Z, et al. Nature. 2014 Feb 12. doi: 10.1038/nature13012.

hqIs180 [sdhb-1p::mtLS::cpYFP + rol-6(su1006)]. Rollers. About six mitoflash events per anterior pharynx per 200 seconds on adult day 3 when cultured on standard NGM plates at 20 ºC. In hqIs180, mtLS is a mitochondrial localization sequence from SDHB-1 and cpYFP is circularly permuted yellow fluorescent protein, a superoxide sensor (Wang W. et al., Cell, 2008). The cpYFP signal is detected in most or all tissues, but most strongly in the pharyngeal muscles. Reference: Shen E-Z, et al. Nature. 2014 Feb 12. doi: 10.1038/nature13012.

irIs83 contains [pMM824 (unc-119::mCherry) + pMM768 (end-3(+))]. isIs83 formed by spotaneous integration of an Ex array in an end-1,3(-) mutant background and was backcrossed to remove end-1,3(-). irIs83 is likely not integrated on LG III, V, or X.

irEx540 [ceh-51(+) + unc-119::CFP + rol-6(su1006)]. Throws arrested ceh-51(-) larvae, rescued animals expressing unc-119::CFP, and some unc-119::CFP-expressing larvae that are not rescued. Heterozygous mutant strain originally obtained from Shohei Mitani.

mirEx123 [myo-3p::TeNL::unc-54 3' UTR]. Maintain strain by picking animals with blue fluorescence. bus-17(br2) has mutant defective response to short wavelength light; response strongly reduced but not eliminated. Altered surface properties; somewhat skiddy movement; drug-sensitive, bleach-sensitive. Resistant to some bacterial pathogens (hence Bus, Bah phenotypes) and hypersensitive to others. Calcium sensitive (Kd 250 nM) teal nanolantern (TeNL) in muscles. Reference: Morales-Curiel LF, et al. Commun Biol. 2022 Dec 3;5(1):1330. doi: 10.1038/s42003-022-04292-x. PMID: 36463346.

Egl. Strain contains both a mec mutation and an egl mutation. Touch insensitive. Abnormal vulva. Forms bags of worms.

Deletion breakpoints: ATCGGGATGAAGTTTGCAAA//AATCTAGAATACCGATTTCG. Transposon silencing abnormal. Only enhanced transposon activity observed in n4503; nDf57 mutants compared to n4503 (not in nDf57 mutants alone).

Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP mfap-1 homozygotes. Pick WT GFP and check for correct segregation of progeny to maintain. mfap-1(n4564 n5214) mutants exhibit temperature-sensitive lethality: at 15°C, (n4564 n5214) homozygous animals grow and behave similarly to wild-type; at 20°C mutant animals grow more slowly, have few progeny and are hyperactive; at 25°C the mutant strain is embryonically lethal. qIs48 is an insertion of ccEx9747 (carries myo-2::GFP, pes-10::GFP, and a gut enhancer fused to GFP) onto the hT2 chromosome and is homozygous lethal. Reference: Ma L, et al. PLoS Genet. 2012;8(7):e1002827.

Backcrossed tph-1(mg280) allele. cam-1 mutation was removed by crossing left and right of tph-1(mg280) using bli-2 and unc-4. Strain does not have withered tail defect and moves well.

vps-50 mutants are abnormal in locomotion and egg laying. n4022 is a strong loss-of-function allele; unknown if null. Reference: Paquin N, et al. Curr Biol. 2016 Apr 4;26(7):862-71. doi: 10.1016/j.cub.2016.01.049. PMID: 26948874.

Double mutant is Muv. lin-35 alone is non-Muv. lin-35 is a class B synthetic Muv.

Double mutant is Multivulva. lin-38 alone is non-Muv. lin-38 is a class A synthetic Muv.

Double mutant is Muv. n758 alone is not Muv.

Double mutant is Muv. lin-36 alone is non-Muv.