| JPS725 |
C. elegans |
ced-6(n1813) III; vxEx725. Show Description
vxEx725 [egl-1p::mCherry::egl-1(G55E, F65D)::egl-1 3'UTR + gcy-32p::GFP::unc-54 3'UTR + unc-122p::GFP]. Pick animals with GFP expression in coelomocytes to maintain. mCherry-tagged EGL-1 visible in URX adult neurons and apoptotic cells. G55E and F65D mutations in the BH3-only region to abolish mCherry::EGL-1 function in inducing cell death. Reference: Wu Z, et al. Proc Natl Acad Sci U S A. 2025 Jan 14;122(2):e2407909122. doi: 10.1073/pnas.2407909122. PMID: 39786930.
|
|
| JR36 |
C. elegans |
cdl-1(e2510)/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
Heterozygotes are WT and segregate WT, dead eggs (homozygous cdl-1(e2510), and Dpy Unc. e2510 carries a missense mutation at the 249th amino acid from Pro to Ser.
|
|
| JT10189 |
C. elegans |
daf-14(m77) IV; scd-2(sa935) V. Show Description
Daf-c strongly but not completely suppressed; some dauers visible at 25C. sa935 alone is moderate Daf-d (dauer defective) in plate starvation assays, and resistant to exogenous dauer pheromone. sa935 confers strong suppression of daf-8 and daf-14, weak suppression of daf-1, -4, -7. scd-2(sa935) single mutant looks WT. snb-1(md247) hypomorph is an excellent balancer for scd-2; snb-1 is immediately neighboring. Maintain at 15 degrees.
|
|
| JT529 |
C. elegans |
ndg-4(sa529) III. Show Description
Ndg: nordihydroguairetic acid resistant. Nrf: nose resistant to fluoxetine-induced hypercontraction. Pale eggs. Accumulates yolk. Some embryonic lethality. Nonsense mutation W404stop(UGA).
|
|
| JT6 |
C. elegans |
exp-1(sa6) II. Show Description
Exp defective. Constipated. May contain a weak daf-2 mutation (sa753). See Ailion and Thomas in Genetics 165: 127-144 2003.
|
|
| JT603 |
C. elegans |
gpb-2(sa603) I. Show Description
Recessive, loss of function, early stop mutation within the coding sequence makes sa603 a likely null allele. Variable locomotion ranging from lethargic to hyperactive. Eat (pale, scrawny). Loopy movement - increased amplitude of locomotory wave-form (variable). Suppresses the enteric muscle contraction (EMC) defect, the lethargy and egg-laying defects of unc-43(n498).
|
|
| JT6130 |
C. elegans |
hsp-90(p673) V. Show Description
Recessive Daf-c mutation that also causes Odr and Che defects. Maintain at 15C. [The mec-1 mutation present in the original isolates has been eliminated.] Previously known as daf-21.
|
|
| JT734 |
C. elegans |
goa-1(sa734) I. Show Description
Recessive, early stop mutation within the coding sequence (C to T substitution in aa52) makes sa734 a likely null allele. May grow slightly better at 15C. Hyperactive, lays early stage eggs, increased amplitude of locomotort wave-form. Suppresses the lethargy and egg-laying defects of unc-43(n498). Reverses direction of locomotion more frequently than WT.
|
|
| KAB72 |
C. elegans |
spin-2(ok2121) IV; spin-1(ok2087) V; spin-3(ok2286) X. Show Description
Triple mutant of the three spinster paralogs expressed exclusively in somatic tissues. Reference: Villalobos TV, et al. Nat Aging. 2023 Sep;3(9):1091-1106. PMID: 37580394.
|
|
| KB12 |
C. elegans |
mir-67(n4899) III; mir-83(n4638) IV. Show Description
Combination mutant made with 6x outcrossed lines KB10 mir-67(n4899) and KB11 mir-83(n4638).
|
|
| KB7 |
C. elegans |
kgb-1(um3) kgb-2(km16) IV. Show Description
Deletion alleles. Can be maintained at 20C. Sterile at 26C. Can use PCR with the following primer to determine whether both deletions are present. (5'end)5'GGTCTACCAGAGTTTGTGCGCAATC3' (3'end)5'GATAGCCTTGCACTTCGTTG3'. PCR products from wild type show two bands; kgb-1 gene shows a smaller band; kgb-2 gene shows a bigger band.The double mutant should have no PCR product. [NOTE: The 5' primer sequence was corrected 03/28/12 (K. Bennett)]
|
|
| KC322 |
C. remanei |
Show Description
Caenorhabditis remanei mutant. Small (non-Mab). Male-female strain.
|
|
| KC421 |
C. remanei |
Show Description
Caenorhabditis remanei mutant. Unc. Male-female strain.
|
|
| KC422 |
C. remanei |
Show Description
Caenorhabditis remanei mutant. Dumpy. Male-female strain.
|
|
| KC423 |
C. remanei |
Show Description
Caenorhabditis remanei mutant. Uncoordinated (coiler). Male-female strain.
|
|
| KC427 |
C. remanei |
Show Description
Caenorhabditis remanei mutant. Unc. Male-female strain.
|
|
| KC431 |
C. remanei |
Show Description
Caenorhabditis remanei mutant. Small (non-Mab)/Dumpy. Male-female strain.
|
|
| KC435 |
C. remanei |
Show Description
Caenorhabditis remanei mutant. Small (non-Mab)/Dumpy. Male-female strain.
|
|
| KC436 |
C. remanei |
Show Description
Caenorhabditis remanei mutant. Dumpy. Male-female strain.
|
|
| KC440 |
C. remanei |
Show Description
Caenorhabditis remanei mutant. Dumpy. Slightly Uncoordinated. Male-female strain.
|
|
| KC441 |
C. remanei |
Show Description
Caenorhabditis remanei mutant. Dumpy. Male-female strain.
|
|
| KC442 |
C. remanei |
Show Description
Caenorhabditis remanei mutant. Dumpy. Male-female strain.
|
|
| KC443 |
C. remanei |
Show Description
Caenorhabditis remanei mutant. Dumpy. Male-female strain.
|
|
| KC467 |
C. remanei |
Show Description
Caenorhabditis remanei mutant. Unc (coiler). Male-female strain.
|
|
| KC470 |
C. remanei |
Show Description
Male-female strain. Caenorhabditis remanei mutant. Dumpy.
|
|
| KG1180 |
C. elegans |
lite-1(ce314) X. Show Description
Defective response to short wavelength light; response strongly reduced but not eliminated. All other characteristics seem wild type, including reponse to mechanosensory stimuli. Strong, probably null, allele. This mutation also blocks the coordinated light response of unc-31(e928) and egl-30(ad805). To identify lite-1 homozygous mutants when crossing into different backgrounds, use a fluorescence stereomicroscope with a GFP filter and zoom to the hightest magnification (60-100X) to distinguish Lite from non-Lite animals. This works best when the animals are mired in thicker parts of the food to slow their spontaneous locomotion but not their response to light. Scan animals around the edge of the food where it is thickest. Leave the lid of the plate off for a minute or so before starting to let the animals adjust to air currents.
|
|
| KG421 |
C. elegans |
gsa-1(ce81) I. Show Description
Coordinated hyperactive locomotion. Hypersensitive to mechanical stimuli. Most mature adults have vulval bump. Mature animals are slightly short and egl-d. Terminal phenotype is usually bag of worms. Population tends to severely crash within 2-3 weeks of starvation. Dominant, gain-of-function allele. Heterozygotes are difficult to distinguish from homozygotes. Mutation is R182C. This same mutation causes constitutive Gs activity in vertebrates. Sequence in WT: CCT TCG GTG TCG. Sequence in ce81: CCT TCG GTG TTG.
|
|
| KG4247 |
C. elegans |
ceIs201 I. Show Description
ceIs201 [unc-17p::ins-22::Venus + unc-17p::RFP + unc-17p::ssmCherry + myo-2p::RFP]; integration site maps to I:0.77. Expresses INS-22::Venus to mark Dense Core Vesicles in the cholinergic nervous system, including the ventral cord cholinergic motor neurons. Also expresses mCherry in the same neurons to help identify the boundaries of the somas, axons, and dendrites. ssmCherry is mCherry with a secretion signal on its N-terminus, which is constitutively secreted and taken up by coelomoctyes in the pseuodcoelomic space, making it a useful marker for those coelomocytes. The INS-22::Venus also gets secreted by DCVs and taken up by coelomocytes. The myo-2::RFP is a co-tranformation marker that lights up the pharyngeal muscle cells and is useful for crossing the integrant into various mutant backgrounds. Reference: Hoover CM, et al. Genetics. 2014 Mar;196(3):745-65.
|
|
| KG4995 |
C. elegans |
rimb-1(ce828) III. Show Description
Superficially wild type on plates. Slight (<10%), but significant, expansion of synaptic vesicles from the synaptic region of the DA9 motor neuron into the flanking asynaptic regions. Synaptic vesicles also showed a slight but significant accumulation in rimb-1 mutant dendrites in the DA9 motor neuron (192 +/- 32% compared to wild type; N=15; P=.015). The sequence GC TAG C TAA A TGA (3 successive stop codons in different reading frames) was inserted after codon 16 of the rimb-1 gene; described in Edwards SL, et al. (manuscript in revision). "Sentryn Acts with a Subset of Active Zone Proteins in the Guided Transport and Capture of Synaptic Vesicles in Caenorhabditis elegans."
|
|
| KG518 |
C. elegans |
acy-1(ce2) III. Show Description
About normal size and distribution on food. Hyperactive locomotion. Hypersensitive to stimuli. Most mature adults have slight vulval bump. Not obviously Egl-d or Egl-c. Dominant, gain-of-function allele. Mutation is P260S. Sequence in WT: CAGTCTGTGATG C CT. Sequence in ce2: CAGTCTGTGATG T CT.
|
|
| KG522 |
C. elegans |
acy-1(md1756) III. Show Description
About normal size. Hyperactive locomotion. Hypersensitive to stimuli. Most mature adults have slight vulval bump. Not obviously Egl-d or Egl-c. Dominant, gain-of-function allele. Mutation is A337T. Sequence in WT: TAAATCT G CCGACG. Sequence in md1756: TAAATCT A CCGACG.
|
|
| KG524 |
C. elegans |
gsa-1(ce94) I. Show Description
Short. Relatively constant motion (coordinated hyperactivity). Adults quickly become Egl-d and most have vulval bump. Hypersensitive to stimuli. Loopy backing, but does not like to back, especially after repeated stimuli. Terminal phenotype is usually bag of worms. Population tends to severely crash after 2-3 weeks of starvation. Dominant, gain-of-function allele. Heterozygotes are also hyperactive and difficult to tell apart from homozygotes. Mutation is G45R. Sequence in WT: GGC GCC G GA GAG AGC. Sequence in ce94: GGC GCC A GA GAG AGC.
|
|
| KG532 |
C. elegans |
kin-2(ce179) X. Show Description
Adults generally short, although some can reach near normal length. Slow growth rate. Backing can be loopy, but does not like to back. Strongly hypersensitive to stimuli. Relatively constant spontaneous movement. Some clustering especially in response to stimuli. Mature adults have vulval bump. Most young adults are Egl-c and young embryos can be found on the plate. Some mature adults become moderately Egl-d. Recessive allele. Males are small and slow growing. Mutation is R92C, which is a conserved residue in the 10 amino acid inhibitory domain that normally functions to keep protein kinase A turned off in the absence of cAMP. Population tends to severely crash within 2-3 weeks of starvation.
|
|
| KG744 |
C. elegans |
pde-4(ce268) II. Show Description
Hyperactive locomotion and hypersensitive to stimuli such as plate dropping. Restores wild type levels of locomotion to paralyzed ric-8(md303) mutants. Most, but not all adults, appear significantly Egl-c. Some mature adults are thinner than normal. Aldicarb sensitivity, growth rate, pumping, length, and distribution on food are all similar to wild type. The ce268 mutation is a D448N change relative to PDE-4D isoform. It disrupts the catalytic domain by changing one of the four active site residues that together chelate an active site zinc atom. Inheritance is semi-dominant due to dominant negative side effects.
|
|
| KJ306 |
C. elegans |
tax-6(jh107) IV. Show Description
Gain-of-function mutant. Hypersensitive to serotonin.
|
|
| KK1228 |
C. elegans |
pkc-3(it309[GFP::pkc-3]) II. Show Description
Superficially wild-type. Note that double homozygous mutants of pkc-3(it309) with par-2(it315) exhibited partially penetrant and variable maternal effect lethality and maternal effect sterility that was stronger than it315 alone. Thus, although the GFP tag on pkc-3 shows no effect in an otherwise wild-type background, it does seem to somewhat compromise the activity of the protein it tags. Made in N2 background.
|
|
| KK1254 |
C. elegans |
par-2(it315[mCherry::par-2]) III. Show Description
par-2(it315) exhibits a weak maternal effect sterility, suggesting that the tag reduces the protein activity. Note, however, that double homozygous mutants of it315 with pkc-3(it309) or par-6(it310) exhibited partially penetrant and variable maternal effect lethality and maternal effect sterility that was stronger than it315 alone. Thus, although the GFP tags on pkc-3 and par-6 show no effect in an otherwise wild-type background, they do seem to somewhat compromise the activity of the proteins they tag. Made in N2 background.
|
|
| KK157 |
C. elegans |
mel-9(b293) II. Show Description
Maternal effect lethal mutation. Temperature sensitive-grow at 15C. Some growth at 20C. Does not grow at 25C. Rescued by male mating.
|
|
| KK312 |
C. elegans |
him-14(it44) II. Show Description
Maternal effect lethal mutation. High incidence of males in surviving offspring. Not rescued by male mating. Temperature sensitive.
|
|
| KK696 |
C. elegans |
ooc-5(it145) unc-4(e120)/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
Heterozygotes are WT and segregate WT, DpyUncs and Sterile Uncs. it145 is a recessive mutation that results in multiple rows of small oocytes instead of a single row of normal size oocytes. it145 is a recessive maternal effect lethal mutation: hermaphrodites produce embryos that fail to hatch - the embryos exhibit a partial defect in P0 nuclear rotation and a strong defect in P1 nuclear rotation; PAR proteins are mislocalized in P1.
|
|
| KP2018 |
C. elegans |
egl-21(n476) IV. Show Description
Mutation confirmed by Nonet lab.
|
|
| KQ1323 |
C. elegans |
akt-2(tm812) sgk-1(ft15) X. Show Description
ft15 allele is a gain-of-function mutation in sgk-1. sgk-1(ft15) mutants have normal body size and normalize the small body size of rict-1 loss-of-function mutants. Reference: Jones KT, et al. PLos Biol. 2009 Mar 3;7(3):e60. doi: 10.1371/journal.pbio.1000060. PMID: 19260765.
|
|
| KQ1564 |
C. elegans |
sgk-1(ft15) X. Show Description
ft15 allele is a gain-of-function mutation in sgk-1. sgk-1(ft15) mutants have normal body size and normalize the small body size of rict-1 loss-of-function mutants. Reference: Jones KT, et al. PLos Biol. 2009 Mar 3;7(3):e60. doi: 10.1371/journal.pbio.1000060. PMID: 19260765.
|
|
| KQ2841 |
C. elegans |
aat-1(ft1003) IV. Show Description
sf1003 is a CRISPR-engineered deletion in aat-1. aat-1(sf1003) mutants show elevated pumping rates and enhanced learning capacity compared to well-fed wild type animals (similar to nkat-1 mutants). Reference: Lin L, et al. Genes Dev. 2020 Aug 1;34(15-16):1033-1038. doi: 10.1101/gad.339119.120. PMID: 32675325.
|
|
| KR1504 |
C. elegans |
let-545(h842) dpy-5(e61) unc-13(e450) I; (rh??) X?; sDp2 (I;f). Show Description
Unc-13 phenotype. Segregates Uncs and lethal DpyUncs (h842 arrests as a sterile adult, and the unlinked mutation results in a tumorous gonad phenotype). Maintain by picking Unc-13 and checking for correct segregation of progeny.
|
|
| KR2151 |
C. elegans |
hIn1 [unc-54(h1040)] I. Show Description
Clear, paralyzed. Mutation is included in the hIn1 inversion. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to Ann Rose.
|
|
| KR2467 |
C. elegans |
dpy-5(e61)/hT2 I; unc-36(e251)/hT2 [bli-4(e937) let-?(h661)] III. Show Description
Heterozygotes are WT and segregate WT, DpyUnc, lethal hT2 homozygotes (arrest stage unknown) and dead eggs (aneuploids). Maintain by picking WT. [March 1995: Apparently the lethal mutation is not in the balanced region. It occasionally crosses off and the strain starts giving Bli-4 hT2 homozygotes again. From Mark Edgley.] This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to Ann Rose.
|
|
| KRA102 |
C. elegans |
lin-39(kas1) III; ynIs40 V; unc-3(n3435) X. Show Description
ynIs40 [flp-11p::GFP] V. kas1 is a point mutation in the second intron splice acceptor site, disrupting splicing. Worms are vulvaless and have severe locomotion defects. Reference: Feng W, et al. Elife. 2020 Jan 3;9. pii: e50065. doi: 10.7554/eLife.50065.
|
|
| KRA235 |
C. elegans |
pha-1(e2123) III; kasEx80. Show Description
kasEx80 [oig-1p::tagRFP::unc-54 3'UTR + pha-1(+)]. Maintain at 25C to maintain array. RFP driven by minimal oig-1 promoter for expression in VD-type GABAergic motor neurons. This construct uses the minimal length of promoter containing overlapping LIN-39 and UNC-30 ChIp-seq peaks (deletion of the single LIN-39 binding site within it compromised GABAergic motor neuron expression). Whereas other available oig-1 constructs are expressed ectopically in cholinergic motor neurons in unc-3 mutants, expression of this construct remains exclusively in GABAergic motor neurons. Reference: Feng W, et al. Elife. 2020 Jan 3;9. pii: e50065. doi: 10.7554/eLife.50065.
|
|
| KRA452 |
C. elegans |
kasEx161. Show Description
kasEx161 [unc-11p::UAG neuro + myo-2::GFP]. Pick GFP+ to maintain array. The transgene drives expression of 75 GGGGCC repeats under the control of unc-11 promoter. The repeats are flanked with human C9orf72 intronic sequences, but the upstream CUG is mutated to UAG. Reference: Sonobe Y, et al. Nat Commun. 2021 Oct 15;12(1):6025. doi: 10.1038/s41467-021-26303-x. PMID: 34654821
|
|