FX19397 |
C. elegans |
tmC1 X; tmEx4487. Show Description
tmEx4487 [unc-18(+) + myo-2p::Venus]. Break points: In(F53B1.2 unc-18 In(lon-2 mec-10)) X. Covered region (Mb) 6.4 (2.1..8.5) Lon Mec (Unc). Pick fluorescent non-Unc to maintain array. Males carrying the array (Venus in pharynx) can mate. Reference: Iwata S, et al. Sci Rep. 2016 Sep 21;6:33840.
|
|
FX30126 |
C. elegans |
tmC1 X. Show Description
Break points: In(F53B1.2 unc-18 In(lon-2 mec-10)) X. Covered region (Mb) 6.4 (2.1..8.5) Lon Unc Mec. Reference: Iwata S, et al. Sci Rep. 2016 Sep 21;6:33840.
|
|
ML93 |
C. elegans |
dpy-2(e489) lin-26(mc1) unc-4(e120)/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
Heterozygotes are WT and segregate WT, DpyUnc and dead eggs (mc1 homozygotes). mc1 is a strong loss of function mutation, but probably not null. mc1 is an embryonic lethal mutation with degeneration of hypodermal cells.
|
|
MT23338 |
C. elegans |
nIs686 III; lin-15B&lin-15A(n765) X. Show Description
nIs686 [gpa-16p::GCaMP3::unc-54 3' UTR + lin-15(+)] III. Expression of GCaMP in RIP, pharyngeal muscle (pm2, pm3, and dimly/occasionally in pm1), mc1 marginal cells, and other unidentified cells. Derived by gamma-irradiation of nEx2309 in parental strain MT23222 and out-crossed five times to MT8189 lin-15B&lin-15A(n765). Reference: Sando SR, et al. eLife 2021;10:e59341 doi: 10.7554/eLife.59341
|
|
MT26375 |
C. elegans |
lin-15B&lin-15A(n765) X; nEx3045. Show Description
nEx3045 [C32F10.8p::GCaMP3::unc-54 3' UTR + lin-15(+)]. Pick non-Muv animals to maintain array. Line is quite stable, ~80% transmission. Expression of GCaMP3 in pm3, mc1, and in other pharyngeal cells posterior to pm3. Reference: Sando SR, et al. eLife 2021;10:e59341 doi: 10.7554/eLife.59341
|
|
BA1061 |
C. elegans |
dpy-18(e364) spe-6(hc49) ale-1(mc14)/qC1 [dpy-19(e1259) glp-1(q339)] III. Show Description
Heterozygotes are WT and segregate WT, Sterile Dpys (Dpy is temperature sensitive), and dead eggs. ale-1 is a recessive embryonic lethal.
|
|
EU3115 |
C elegans |
klp-15(ok1958) klp-16(or1952)/tmC18[dpy-5(tmIs1236)] I; ltIs37 IV; ruIs57. Show Description
ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. ruIs57 [pie-1p::GFP::tubulin + unc-119(+)]. tmC18 balancer marked with myo-2p::mCherry and Dpy. Heterozygotes are wild-type with pharyngeal mCherry, and segregate mCherry+ heterozygotes, tmC18 homozygotes (mCherry+ Dpy) and non-mCherry klp-15/16 homozygotes. Homozygous double deletion mutants are fertile but produced reduced brood sizes with highly penetrant embryonic lethality; will also segregate some males. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.] Reference: Chuang CH, et al., Biology Open 2020 9: bio052308 doi: 10.1242/bio.052308 Published 25 June 2020
|
|
EU3201 |
C elegans |
klp-15(ok1958) aspm-1(syb1260[gfp::aspm-1]) klp-16(or1952) /tmC18[dpy-5(tmIs1236)] I; ltIs37[pie-1p::mCherry::H2B::pie-1 3'UTR + unc-119(+)] IV Show Description
ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. ruIs57 [pie-1p::GFP::tubulin + unc-119(+)]. GFP tag inserted into endogenous aspm-1 locus. tmC18 balancer marked with myo-2p::mCherry and Dpy. Heterozygotes are wild-type with pharyngeal mCherry, and segregate mCherry+ heterozygotes, tmC18 homozygotes (mCherry+ Dpy) and non-mCherry triple mutant homozygotes. Homozygous triple mutants are fertile but produced reduced brood sizes with highly penetrant embryonic lethality; will also segregate some males. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.] Reference: Chuang CH, et al., Biology Open 2020 9: bio052308 doi: 10.1242/bio.052308 Published 25 June 2020
|
|
FX30152 |
C. elegans |
tmC12 [egl-9(tmIs1194)] V. Show Description
Break points: In(hlh-10 C01G10.10 In(unc-23 lon-3)) V. Covered region (Mb) 6.1 (8.9..15.1) Balancer marked with myo-2p::Venus. Lon Unc. Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.
|
|
FX30153 |
C. elegans |
tmC12 [egl-9(tmIs1197)] V. Show Description
Break points: In(hlh-10 C01G10.10 In(unc-23 lon-3)) V. Covered region (Mb) 6.1 (8.9..15.1) Balancer marked with myo-2p::mCherry. Lon Unc. Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.
|
|
FX30154 |
C. elegans |
tmC12 V. Show Description
Break points: In(hlh-10 C01G10.10 In(unc-23 lon-3)) V. Covered region (Mb) 6.1 (8.9..15.1) Lon Unc. Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.
|
|
FX30161 |
C. elegans |
tmC16 [unc-60(tmIs1237)] V. Show Description
Break points: In(flp-34 C04E6.7 In(srbc-66 T10H9.8)) V. Covered region (Mb) 5.6 (1..6.7) Balancer marked with myo-2p::mCherry. Unc. Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.
|
|
FX30162 |
C. elegans |
tmC16 V. Show Description
Break points: In(flp-34 C04E6.7 In(srbc-66 T10H9.8)) V. Covered region (Mb) 5.6 (1..6.7) Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.
|
|
FX30164 |
C. elegans |
tmC16 [unc-60(tm9712)] V. Show Description
Break points: In(flp-34 C04E6.7 In(srbc-66 T10H9.8)) V. Covered region (Mb) 5.6 (1..6.7) Unc. Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.
|
|
FX30166 |
C. elegans |
tmC18 I. Show Description
Break points: In(B0207.10 dnj-27 In(gsp-3 sre-23)) I. Covered region (Mb) 7.2 (4.7..11.9) Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.
|
|
FX30167 |
C. elegans |
tmC18 [dpy-5(tmIs1200)] I. Show Description
Break points: In(B0207.10 dnj-27 In(gsp-3 sre-23)) I. Covered region (Mb) 7.2 (4.7..11.9) Balancer marked with myo-2p::Venus. Dpy. Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.
|
|
FX30168 |
C. elegans |
tmC18 [dpy-5(tmIs1236)] I. Show Description
Break points: In(B0207.10 dnj-27 In(gsp-3 sre-23)) I. Covered region (Mb) 7.2 (4.7..11.9) Balancer marked with myo-2p::mCherry. Dpy. Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.
|
|
FX30233 |
C. elegans |
tmC16 [unc-60(tmIs1210)] V. Show Description
Break points: In(flp-34 C04E6.7 In(srbc-66 T10H9.8)) V. Covered region (Mb) 5.6 (1..6.7) Balancer marked with myo-2p::Venus. Unc. Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.
|
|
FX30238 |
C. elegans |
tmC18 [dpy-5(tm9705)] I. Show Description
Break points: In(B0207.10 dnj-27 In(gsp-3 sre-23)) I. Covered region (Mb) 7.2 (4.7..11.9) Dpy. Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.
|
|
GMC101 |
C. elegans |
dvIs100. Show Description
dvIs100 [unc-54p::A-beta-1-42::unc-54 3'-UTR + mtl-2p::GFP]. mtl-2p::GFP produces constitutive expression of GFP in intestinal cells. unc-54p::A-beta-1-42 expresses full-length human A-beta-1-42 peptide in bodywall muscle cells that aggregates in vivo. Shifting L4 or young adult animals from 20C to 25C causes paralysis. Reference: McColl G, et al. Mol Neurodegener. 2012 Nov 21;7:57.
|
|
ML2615 |
C.elegans |
dlg-1(mc103[dlg-1::gfp]) X. Show Description
Superficially wild-type. Endogenous dlg-1 locus tagged with GFP.
|
|
ML456 |
C. elegans |
ale-1(mc14)/spe-6(hc49) unc-25(e156) III. Show Description
Heterozygotes are WT and segregate WT, embryonic lethals (embryos fail to elongate) and Sterile Uncs. mc14 identified as a mutation that leads to abnormal lin-26 expression.
|
|
ML581 |
C. elegans |
lin-26(mc15) unc-4(e120)/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
Heterozygotes are WT and segregate dead eggs, DpyUncs and WT. lin-26(mc15) is a molecular null due to a deletion of most of lin-26 coding sequence.
|
|
UDN100022 |
C. elegans |
rab-5(udn11)/tmC18 [dpy-5(tmIs1200)] I. Show Description
rab-5 [D135D]. Silent BstAPI site added in D135D allele for ease of genotyping. Balancer marked with myo-2p::Venus. Reference: Huang et al. 2022. PMID: 35121658
|
|
UDN100028 |
C. elegans |
rab-5(udn14)/tmC18 [dpy-5(tmIs1200)] I. Show Description
Must be maintained at 20 degrees. Homozygous lethal rab-5 [D135H] mutation balanced by tmC18. Balancer marked with myo-2p::Venus. Heterozygotes are WT with pharyngeal Venus fluorescence, and segregate Venus+ heterozygotes, non-Venus rab-5[D135H] homozygotes (L1 lethal), and Dpy Venus+ tmC18 homozygotes. Pick fertile wild-type Venus+ to maintain. Silent BstAPI site added in D135H for genotyping ease. Heterozygous rab-5[D135H] animals are small and have decreased locomotion. Reference: Huang et al. 2022. PMID: 35121658
|
|
UDN100035 |
C. elegans |
rab-5(udn17)/tmC18 [dpy-5(tmIs1200)] I. Show Description
Homozygous lethal rab-5 [Q78R] mutation balanced by tmC18. Balancer marked with myo-2p::Venus. Heterozygotes are WT with pharyngeal Venus fluorescence, and segregate Venus+ heterozygotes, non-Venus rab-5 [Q78R] homozygotes (L1 lethal), and Dpy Venus+ tmC18 homozygotes. Pick fertile wild-type Venus+ to maintain. Silent KpnI site added in Q78R for genotyping ease. Reference: Huang et al. 2022. PMID: 35121658
|
|
UDN100037 |
C. elegans |
rab-5(udn15)/tmC18 [dpy-5(tmIs1200)] I. Show Description
rab-5 [Q78Q]/tmC18 I. Control edit mutation maintained over tmC18. Balancer marked with myo-2p::Venus. Heterozygotes are WT with pharyngeal Venus fluorescence, and segregate Venus+ heterozygotes, non-Venus rab-5 [Q78Q] homozygotes (viable and fertile), and Dpy Venus+ tmC18 homozygotes. Pick fertile wild-type Venus+ to maintain. NOTE: udn15 is essentially wild-type. Pick Venus+ to prevent non-Venus rab-5 [Q78Q] homozygotes from taking over the population and losing the balancer! Silent KpnI site added in Q78Q allele for ease of genotyping. Reference: Huang et al. 2022. PMID: 35121658
|
|
UDN100103 |
C. elegans |
rab-5(udn49)/tmC18 [dpy-5(tmIs1200)] I. Show Description
Homozygous lethal rab-5 [A29P] mutation balanced by tmC18. Balancer marked with myo-2p::Venus. Heterozygotes are WT with pharyngeal Venus fluorescence, and segregate Venus+ heterozygotes, non-Venus rab-5 [A29P] homozygotes (L1 lethal), and Dpy Venus+ tmC18 homozygotes. Pick fertile wild-type Venus+ to maintain. Silent DdeI site added in A29P for genotyping ease. Reference: Huang et al. 2022. PMID: 35121658
|
|
UDN100126 |
C. elegans |
rab-5(udn64)/tmC18 [dpy-5(tmIs1236)] I; udnSi38 II. Show Description
udnSi38 [rab5p::rab-5] II. Maintain at 20 degrees. rab-5 [D135N] variant edit #2 with a single copy of wild-type rab-5 integrated into chromosome II at ttTi5605 site (II: 0.77). Homozygous lethal rab-5 [D135N] mutation balanced by tmC18. Balancer marked with myo-2p::mCherry. Heterozygotes are WT with pharyngeal mCherry fluorescence, and segregate mCherry + heterozygotes, non-mCherry rab-5 [D135N] homozygotes (L1 lethal), and Dpy mCherry+ tmC18 homozygotes. Pick fertile wild-type mCherry+ to maintain. [D135N]/ [D135N]; udnSi38/udnSi38 double homozygotes are lethal. Reference: Huang et al. 2022. PMID: 35121658
|
|
UDN100145 |
C. elegans |
rab-5(udn47)/tmC18 [dpy-5(tmIs1200)] I. Show Description
rab-5 [A29A]/tmC18 I. Control edit mutation maintained over tmC18. Balancer marked with myo-2p::Venus. Heterozygotes are WT with pharyngeal Venus fluorescence, and segregate Venus+ heterozygotes, non-Venus rab-5 [A29A] homozygotes (viable and fertile), and Dpy Venus+ tmC18 homozygotes. Pick fertile wild-type Venus+ to maintain. NOTE: udn47 is essentially wild-type. Pick Venus+ to prevent non-Venus rab-5 [A29A] homozygotes from taking over the population and losing the balancer! Silent DdeI site added in A29A allele for ease of genotyping. Reference: Huang et al. 2022. PMID: 35121658
|
|
VC4098 |
C. elegans |
hrpk-1(gk5045[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/tmC18 [dpy-5(tmIs1236)] I. Show Description
Homozygous sterile deletion balanced by tmC18. Heterozygotes are wild-type with pharyngeal GFP+RFP+, and segregate GFP+RFP+ heterozygotes, GFP+ gk5045 homozygotes (most commonly sterile, but occasional animals will lay eggs that hatch, and a population of homozygotes can be maintained), and tmC18 homozygotes (Dpy-5 with myo-2 mCherry). Pick fertile wild-type GFP+RFP+ to maintain. Deletion of 1976 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TCAAAATGATGATCAAAGTGGGAGCCGCTA ; Right flanking sequence: GGTGGATCTGTCTAGGTTCTGGTGTTCGTA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
VC4100 |
C. elegans |
lron-9(gk5062[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/tmC18 [dpy-5(tmIs1236)] I. Show Description
Homozygous lethal deletion balanced by tmC18. Heterozygotes are WT with pharyngeal GFP, and segregate GFP heterozygotes, GFP gk5062 homozygotes (arrest stage undetermined), and tmC18 homozygotes (Dpy-5 with myo-2 mCherry). Pick fertile wild-type GFP+ to maintain. Deletion of 2039 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TGCTGTCGTATTTTTGTTACAGTACCTACG ; Right flanking sequence: GGTGGTTGGAAGATTCCATCAGCACGTGAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|