Strain Information
| Name | MLC2543 View On Wormbase |
|---|---|
| Species | C. elegans |
| Genotype | dct-1(luc194) X. |
| Description | CRISPR/Cas9-engineered deletion removes the entire dct-1 coding sequence. Homozygote mutant animals are viable and have normal morphology. Outer left sequence: gtttcagagacgggtctttcctaaca Outer right sequence: ttccaaacaaaaattttaacgttcgactta sgRNA1: ACAGCAGACGGAGCAGTCAT sgRNA2: GTACAGTGAAATGAGGTAAG Reference: Gutiérrez-Pérez, P. et al. A deeply conserved miR-1 dependent regulon supports muscle cell physiology. bioRxiv, 2020, doi.org/10.1101/2020.08.31.275644. |
| Mutagen | Crispr/Cas9 |
| Outcrossed | x0 |
| Made by | Paula Gutiérrez-Pérez |
| Laboratory | MLC |
| Reference | Gutiérrez-Pérez, P. et al. A deeply conserved miR-1 dependent regulon supports muscle cell physiology. bioRxiv, 2020, doi.org/10.1101/2020.08.31.275644. |
Sign in
or
register an account if you want to order this strain.