Search Strains

Fewer Fields See WormTagDB for other published tagged loci.
Strain Species Genotype Add
MQ470 C. elegans rop-1(pk93) V. Show Description
No visible phenotype. Severely decreased levels of the RoRNP-associated CeY RNA. Higher frequency of mutant 5S rRNA molecules into rop-1 ribosomes. See also WBPaper00003694.
RB2032 C. elegans rop-1(ok2690) V. Show Description
C12D8.11. Homozygous. Outer Left Sequence: AAGGCCACAATCTGTTCTGC. Outer Right Sequence: GACAAGAAGCAACCCCAAAA. Inner Left Sequence: CTTGTCCGATCTTCCAATCC. Inner Right Sequence: ACACCATGAGCTGGTTCACA. Inner Primer PCR Length: 3130 bp. Deletion Size: 1172 bp. Deletion left flank: TAATCTGAGTAGGCATTGAGCATTGGACAT. Deletion right flank: GTTTTGCACACAGTAACTACTAAATTCAAT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
SOZ300 C.elegans cyp-37A1(ssd9) II. Show Description
ssd9 is a Class III supersized lipid droplet mutation. 68bp deletion 5' flanking sequence: cacacatccgtacgtggtgg. 3' flanking sequence: cgacaactgattggttatga References: Li S, et al. G3 (Bethesda). 2016 Aug 9;6(8):2407-19. Li S, et al. Proc Natl Acad Sci U S A. 2017 Aug 15;114(33):8841-8846. cyp-37A1 previously known as drop-1.