Search Strains

asEx98 [spe-21(+) + myo-3::GFP]. Pick GFP+ animals to maintain. syb(4299) is a non-conditional allele of spe-21. Mutant hermaphrodites and males are severly subfertile. Array carries a fragment (PCR product) of R13F6.5 containing a wild-type copy spe-21(+). spe-21/R13F6.5 formerly known as dhhc-5. The extrachromosomal array effectively rescues the fertility defect. Reference: Suryanarayanan S, et al. bioRxiv 2025.03.03.641263; doi: https://doi.org/10.1101/2025.03.03.641263.

mNeonGreen tag inserted at the C-terminus of the endogenous spe-21 locus by CRISPR. Expression in the membranous organelles of sperm. Reference: Suryanarayanan S, et al. bioRxiv 2025.03.03.641263; doi: https://doi.org/10.1101/2025.03.03.641263.

umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Semi sterile. Deletion of 1602 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 ve1041 homozygotes (mostly sterile; see below), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Most ve1051 homozygotes lay only oocytes, but a few escaper ve1041 GFP+ hemaphrodites can lay small broods of similarly semi-sterile progeny. Left flanking Sequence: GCGAGATTTGGTAACTGAAAAAGGTAACCA; Right flanking sequence: ATTCGGCAAAATCAGATAATAAGAAATTCG. dhhc-5 crRNA A: TGGGTGCATGGACTATTGCA; dhhc-5 crRNA B: GTGGTTGGAACGCACAAAGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.