Search Strains

More Fields See WormTagDB for other published tagged loci.
Strain Species Genotype Add
PHX2015 C. elegans ceh-58(syb2015[ceh-58::GFP]) II. Show Description
Superficially wild-type. Insertion of GFP and FLAG tags directly before the stop codon of endogenous ceh-58 locus. Verified by sequencing. Reference: Reilly MB, et al. Nature. 2020 Aug;584(7822):595-601. PMID: 32814896.
PHX2361 C.elegans egl-5(syb2361[egl-5::mNG::3xFLAG::AID*]) III. Show Description
mNeonGreen::3xFLAG::AID* tags inserted into endogenous egl-5 locus. No phenotypes have been observed. Reference: Smith JJ, et al. Cell Rep. 2024 Mar 26;43(3):113857. doi: 10.1016/j.celrep.2024.113857. PMID: 38421866.
PHX2517 C. elegans ceh-86(syb2517[ceh-86::GFP::FLAG]) II. Show Description
Superficially wild-type. Insertion of GFP and FLAG tags directly before the stop codon of endogenous ceh-86 locus. Verified by sequencing. Reference: Reilly MB, et al. Nature. 2020 Aug;584(7822):595-601. PMID: 32814896.
PHX3364 C. elegans eif-2D(syb3364[eif-2D::GFPnovo2::3xFLAG]) II. Show Description
Endogenous eif-2D locus tagged with GFPnovo2 and 3xFLAG. Reference: Sonobe Y, et al. Nat Commun. 2021 Oct 15;12(1):6025. doi: 10.1038/s41467-021-26303-x. PMID: 34654821
PHX3432 C. elegans eif-2D(syb3432[(delta)SUI1 domain +3xFLAG]) II. Show Description
Endogenous eif-2D locus tagged with 3xFLAG. The SUI1 domain of the endogenous EIF-2D locus has been deleted and replaced with 3xFLAG via CRISPR/Cas9 gene editing. Reference: Sonobe Y, et al. Nat Commun. 2021 Oct 15;12(1):6025. doi: 10.1038/s41467-021-26303-x. PMID: 34654821
PHX5755 C. elegans pha-4(syb5755[pha-4::3xGAS::GFP::3xGAS::AID*::TEV::LoxP::3xFLAG] *ot1078 *ot946) V. Show Description
Endogenously-tagged pha-4 locus allele modified for auxin dependent protein degradation. ot946 [pha-4::3xGAS::GFP::TEV::LoxP::3xFLAG]. ot1078 added a second loxP site to the first intron (+278). syb5755 added 3xGAS::AID* after the GFP tag. Please contact Oliver Hobert prior to publishing work using this strain.
PHX5804 C. elegans egl-3(syb5804[flag::NLS::Cre::SL2::egl-3]) V. Show Description
Cre inserted into the endogenous egl-3 locus by CRISPR. Pan-neuronal expression of Cre. Allele generated by SUNY Biotech. Please contact Oliver Hobert prior to publishing work using this strain.
PHX5859 C. elegans ceh-48(syb5859[flag::NLS::Cre::SL2::ceh-48]) IV. Show Description
Cre inserted into the endogenous ceh-48 locus by CRISPR. Pan-neuronal expression of Cre. Allele generated by SUNY Biotech. Please contact Oliver Hobert prior to publishing work using this strain.
PHX6129 C. elegans ieSi57 II; Y47D3A.21(syb6129[GFP::AID*:::3Xflag::3xGAS::Y47D3A.21]) III. Show Description
ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. GFP, AID*, 3xFLAG, and 3xGAS tags inserted into endogenous Y47D3A.21 locus. Reference: Sharma N, et al. bioRxiv [Preprint]. 2024 Jan 19:2024.01.16.575916. doi: 10.1101/2024.01.16.575916. PMID: 38293206.
PHX6730 C.elegans mab-5(syb6730[mab-5::3xFLAG::mNG::AID*)]) III. Show Description
3xFLAG, mNeonGreen, and AID* tags inserted into endogenous mab-5 locus. No phenotypes have been observed. Reference: Smith JJ, et al. Cell Rep. 2024 Mar 26;43(3):113857. doi: 10.1016/j.celrep.2024.113857. PMID: 38421866.
PHX8406 C. elegans tol-1(syb8406[3xLinker::WrmScarlet::linker::3xFLAG]) I. Show Description
WrmScarlet and 3xFlag tags inserted into endogenous tol-1 locus. Reference: Carmona-Rosas G, et al. bioRxiv 2023.05.04.539414; doi: https://doi.org/10.1101/2023.05.04.539414.
PHX8408 C. elegans lat-1(syb8408[lat-1AAAAA::EGFP::linker::3xFLAG::AAAAA]) II. Show Description
Internal eGFP and FLAG tags with poly-A linkers inserted into endogenous lat-1 locus before 651 aa. Reference: Carmona-Rosas G, et al. bioRxiv 2023.05.04.539414; doi: https://doi.org/10.1101/2023.05.04.539414.
PHX8810 C. elegans tol-1(syb8810[tol-1 Q712A,Y713A,G714A,N715A] *syb8406) I. Show Description
CRISPR/Cas9-engineered mutation of residues that mediate interaction with TOL-1 receptor in development. Reduced brood size, high levels of embryonic and larval arrest. syb8406 is WrmScarlet and 3xFlag tags inserted into endogenous tol-1 locus. Reference: Carmona-Rosas G, et al. bioRxiv 2023.05.04.539414; doi: https://doi.org/10.1101/2023.05.04.539414.
PHX8955 C. elegans lat-1(syb8955[lat-1 F69A] *syb8408) II. Show Description
Engineered F69A mutation in endogenously-tagged lat-1 locus. Slightly reduced brood size. syb8408 is internal eGFP and FLAG tags with poly-A linkers inserted into endogenous lat-1 locus before 651 aa. Reference: Carmona-Rosas G, et al. bioRxiv 2023.05.04.539414; doi: https://doi.org/10.1101/2023.05.04.539414.
PHX9026 C. elegans lat-1(syb9026[lat-1(delta Lec)] *syb8408) II. Show Description
CRISPR/Cas9-engineered deletion of Lectin domain within endogenously-tagged LAT-1A. Internal eGFP and FLAG tags with poly-A linkers inserted into endogenous lat-1 locus before 651 aa. Reduced brood size and high levels of embryonic and larval lethality. Reference: Carmona-Rosas G, et al. bioRxiv 2023.05.04.539414; doi: https://doi.org/10.1101/2023.05.04.539414.
PHX945 C.elegans nish-1(syb767) IV; sybIs62. Show Description
sybIs62 [NISH-1::EGFP::3xFLAG + unc-119(+) + myo-2p::mCherry]. Transgene rescues nish-1(syb767) rilemenidine-induced longevity, rilemenidine-induced heat resistance, and rilemenidine-induced healthspan (body bends). Reference: Bennett DF, et al. Aging Cell. 2023 Feb;22(2):e13774. doi: 10.1111/acel.13774. PMID: 36670049.
PQ530 C. elegans alg-1(ap423[3xflag::gfp::alg-1]) X. Show Description
alg-1(ap423 [3xflag::gfp::alg-1]) X. ALG-1 tagged at N-terminal with 3xFLAG:GFP at endogenous locus, verified by western blot and fluorescence microscopy. Reference: Aalto AP, et al. PLoS Genet. 2018 Jun 21;14(6):e1007379.
PQ582 C. elegans alg-2(ap431[3xflag::mKate2::alg-2]) II. Show Description
alg-2(ap431[3xflag::mKate2::alg-2]) II. ALG-2 tagged at N-terminal with 3xFLAG:mKate2 at endogenous locus, verified by western blot and fluorescence microscopy. Reference: Aalto AP, et al. PLoS Genet. 2018 Jun 21;14(6):e1007379.
PQ583 C. elegans alg-2(ap431[3xflag::mKate2::alg-2]) II; alg-1(ap423[3xflag::gfp::alg-1]) X. Show Description
alg-2(ap431[3xflag::mKate2::alg-2]) II. alg-1(ap423[3xflag::gfp::alg-1]) X. Derived from crossing PQ530 and PQ582 strains, verified by fluorescence microscopy. Reference: Aalto AP, et al. PLoS Genet. 2018 Jun 21;14(6):e1007379.
PS10640 C. elegans cmk-1(sy2277[cmk-1::mKate2::AID*::3xFLAG) IV; syIs875. Show Description
syIs875 [ins-6p::dYFP + ins-6::mCherry + unc-122p::GFP]. cmk-1(sy2277) is a C-terminal knock-in of mKate2::AID*::FLAG to be used for conditional degradation of CMK-1 protein. sy2277 is a CRISPR-engineered allele generated using the self-excising cassette (SEC) method (Dickinson et al. 2015, Genetics) with the gRNA sequence 5'-AGCGTGAAAAGCGGGTGTAGNGG-3' (note: NGG not included in the gRNA). syIs875 is an integrated transgene that includes a transcriptional and translational reporter for ins-6 and is marked by GFP in the coelomocytes. dYFP signal can be seen in ASI during reproductive growth and in ASJ (strong) and ASI (weaker) during dauer exit. Reference: Zhang MG, et al. (2024). Available at: https://www.biorxiv.org/content/10.1101/2024.03.20.586022v1 [Accessed 13 August 2024].
QK67 C. elegans alg-1(xk5[3xFLAG::alg-1]) X. Show Description
3xFLAG tag inserted at N-terminus of short isoform of endogenous alg-1 locus. Reference: Kotagama K, et al. Nucleic Acids Res. 2024 May 22;52(9):4985-5001. doi: 10.1093/nar/gkae170. PMID: 38471816.
QP1961 C. elegans eaIs4. Show Description
eaIs4 [him-5p::him-5::GFP::3xFLAG::him-5 3'UTR + unc-119(+)]. Transgene recapitulates published HIM-5 expression patterns and can rescue high incidence of males phenotype of him-5 mutants. Reference: McClendon TB. et al. G3 (Bethesda). 2016 Dec 7;6(12):3913-3925. PMID 27678523.
RAF2181 C. elegans ieSi57 II; daf-2(bch-40[AID*::3xFLAG::STOP::SL2::SV40::AID*::wrmScarlet::egl-13NLS]) unc-119(ed3) III. Show Description
ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. AID* tag inserted into endogenous daf-2 locus. ieSi57 is a single-copy transgene insertion into chromosome II (oxTi179) expressing modified Arabidopsis thaliana TIR1 tagged with mRuby in the soma. This strain can be used for auxin-inducible degradation (AID) of target proteins in somatic tissues. Reference: Venz R, et al. Elife. 2021 Sep 10;10:e71335. doi: 10.7554/eLife.71335. PMID: 34505574.
RJP5269 C. elegans unc-31(rp166[GFP::TEV::AID*::FLAG::unc-31]) IV. Show Description
N-terminal GFP::TEV::AID*::FLAG tag inserted into endogenous unc-31 locus using CRISPR/Cas9. crRNA (TTTTCAGGAGGATCATGATT). Reference: Cornell R, et al. J Neurosci. 2022 Oct 26;JN-RM-1368-22. doi: 10.1523/JNEUROSCI.1368-22.2022. PMID: 36302635
RJP5296 C. elegans reSi7 I; unc-31(rp166[GFP::TEV::AID*::FLAG::unc-31]) IV. Show Description
reSi7 [rgef-1p::TIR1::F2A::mTagBFP2::AID*::NLS::tbb-2 3'UTR] (I:-5.32). Neuronal-specific expression of TIR1 co-factor with N-terminal GFP::TEV::AID*::FLAG tag inserted into endogenous unc-31 locus using CRISPR/Cas9 can be used for conditional depletion of UNC-31 in the nervous system. crRNA (TTTTCAGGAGGATCATGATT). Reference: Cornell R, et al. J Neurosci. 2022 Oct 26;JN-RM-1368-22. doi: 10.1523/JNEUROSCI.1368-22.2022. PMID: 36302635. NOTE: PCR detection of reSi7 insert using the published primers has been reported to be defective. These primers designed by Sherlyn Wijaya and Claire Richardson to detect ttTi4338 (LG I) also work for reIs7: ttTi4338 (LG I) wrdSi23-F: cttcaaagaaatcgccgac wrdSi23-FP: AACAACGAGACCTACGTCG wrdSi23-R: Ctctaagatgtcggccac (wt ~300bp, mutant ~650bp).
RP3510 C elegans trEx1010. Show Description
trEx1010 [pgp-14p::sms-5B(genomic)::Flag::mCherry + pgp-14p::YFP::pgp-14]. Pick animals with mCherry+ pharynx to maintain. Fluorescence is more apparent in older animals (late stage larvae to young adults). Generated in N2 background. Reference: Kamal M, et al. bioRxiv 2022.03.11.483951; doi: https://doi.org/10.1101/2022.03.11.483951.
RW10312 C. elegans unc-119(tm4063) III; stIs10312. Show Description
stIs10312 [lim-7::TY1::EGFP::3xFLAG + unc-119(+)].
RW10316 C. elegans unc-119(ed3) III; stIs10316. Show Description
stIs10316 [die-1::TY1::EGFP::3xFLAG + unc-119(+)].
RW10325 C. elegans unc-119(ed3) III; stIs10325. Show Description
stIs10325 [mes-4::TY1::EGFP::3xFLAG + unc-119(+)].
RW10348 C. elegans unc-119(ed3) III; ltIs37 IV; stIs10116; stIs10318. Show Description
ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. stIs10116 [his-72(promoter)::his-24::mCherry::let-858 3'UTR + unc-119(+)]. stIs10318 [nhr-25::TGF(3H4)::GFP::TY1::3xFLAG inserted into fosmid WRM0617dE06 as C-terminal protein fusion]. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.]
RW10349 C. elegans unc-119(ed3) III; ltIs37 IV; stIs10116; stIs10311. Show Description
ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. stIs10116 [his-72(promoter)::his-24::mCherry::let-858 3'UTR + unc-119(+)]. stIs10311 [lin-39::TGF(3D3)::GFP::TY1::3xFLAG inserted into fosmid WRM0617dE06 as C-terminal protein fusion]. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.]
RW10350 C. elegans unc-119(ed3) III; ltIs37 IV; stIs10116; stIs10309. Show Description
ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. stIs10116 [his-72(promoter)::his-24::mCherry::let-858 3'UTR + unc-119(+)]. stIs10309 [mab-5::TY1::eGFP::3xFLAG(P000007_E01)]. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.]
RW10425 C. elegans unc-119(ed3) III; ltIs37 IV; stIs10116; stIs10389. Show Description
ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. stIs10116 [his-72(promoter)::his-24::mCherry::let-858 3'UTR + unc-119(+)]. stIs10389 [pha-4::TGF(3E3)::GFP::TY1::3xFLAG inserted into fosmid WRM0617dE06 as C-terminal protein fusion]. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.]
RW10429 C. elegans unc-119(ed3) III; gaIs269. Show Description
gaIs269 [nhr-23::TY1::EGFP::3xFLAG + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in fosmid P000006_G11.
RW10434 C. elegans unc-119(ed3) III; ltIs37 IV; stIs10116; stIs10394. Show Description
ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. stIs10116 [his-72(promoter)::his-24::mCherry::let-858 3'UTR + unc-119(+)]. stIs10394 [cnd-1::TGF(3C3)::GFP::TY1::3xFLAG inserted into fosmid WRM0617dE06 as C-terminal protein fusion]. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.]
RW10455 C. elegans unc-119(ed3) III; stIs10455. Show Description
st10455 [elt-7::TY1::EGFP::3xFLAG + unc-119(+)].
RW10470 C. elegans unc-119(ed3) III; stIs10470. Show Description
stIs10470 [tbx-8::TY1::EGFP::3xFLAG + unc-119(+)].
RW10479 C. elegans unc-119(ed3) III; ltIs37 IV; stIs10116; stIs10426. Show Description
ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. stIs10116 [his-72(promoter)::his-24::mCherry::let-858 3'UTR + unc-119(+)]. stIs10426 [med-2::TGF(6.2B3)::GFP::TY1::3xFLAG inserted into fosmid WRM0617dE06 as C-terminal protein fusion]. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.]
RW10481 C. elegans unc-119(ed3) III; ltIs37 IV; stIs10116; stIs10436. Show Description
ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. stIs10116 [his-72(promoter)::his-24::mCherry::let-858 3'UTR + unc-119(+)]. stIs10436 [hlh-1::TGF(6.2B4)::GFP::TY1::3xFLAG inserted into fosmid WRM0617dE06 as C-terminal protein fusion]. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.]
RW10493 C. elegans unc-119(ed3) III; ltIs37 IV; stIs10116; stIs10472. Show Description
ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. stIs10116 [his-72(promoter)::his-24::mCherry::let-858 3'UTR + unc-119(+)]. stIs10472 [lin-11::TGF(7H3)::GFP::TY1::3xFLAG inserted into fosmid WRM0617dE06 as C-terminal protein fusion]. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.]
RW10558 C. elegans unc-119(ed3) III; ltIs37 IV; stIs10116; stIs10470. Show Description
ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. stIs10116 [his-72(promoter)::his-24::mCherry::let-858 3'UTR + unc-119(+)]. stIs10470 [tbx-8::TGF(7G2)::GFP::TY1::3xFLAG inserted into fosmid WRM0617dE06 as C-terminal protein fusion]. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.]
RW10560 C. elegans unc-119(ed3) III; ltIs37 IV; stIs10116; stIs10452. Show Description
ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. stIs10116 [his-72(promoter)::his-24::mCherry::let-858 3'UTR + unc-119(+)]. stIs10452 [lin-13::TGF(6.2B12)::GFP::TY1::3xFLAG inserted into fosmid WRM0617dE06 as C-terminal protein fusion]. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.]
RW10563 C. elegans unc-119(ed3) III; stIs10563. Show Description
st10563 [glp-1::TY1::EGFP::3xFLAG + unc-119(+)].
RW10702 C. elegans unc-119(ed3) III; stIs10702. Show Description
stIs10702 [hlh-6::TY1::EGFP::3xFLAG + unc-119(+)].
RW10713 C. elegans unc-119(ed3) III; ltIs37 IV; stIs10116; stIs10485. Show Description
ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. stIs10116 [his-72(promoter)::his-24::mCherry::let-858 3'UTR + unc-119(+)]. stIs10485 [ttx-3::TGF(8G1)::GFP::TY1::3xFLAG inserted into fosmid WRM0617dE06 as C-terminal protein fusion]. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.]
RW10714 C. elegans unc-119(ed3) III; ltIs37 IV; stIs10116; stIs10453. Show Description
ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. stIs10116 [his-72(promoter)::his-24::mCherry::let-858 3'UTR + unc-119(+)]. stIs10453 [elt-2::TGF(7E1)::GFP::TY1::3xFLAG inserted into fosmid WRM0617dE06 as C-terminal protein fusion]. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.]
RW10726 C. elegans unc-119(ed3) III; ltIs37 IV; stIs10116; stIs10525. Show Description
ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. stIs10116 [his-72(promoter)::his-24::mCherry::let-858 3'UTR + unc-119(+)]. stIs10525 [ceh-14::TGF(8F2)::GFP::TY1::3xFLAG inserted into fosmid WRM0617dE06 as C-terminal protein fusion]. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.]
RW10757 C. elegans unc-119(ed3) III; ltIs37 IV; stIs10116; stIs10757. Show Description
ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. stIs10116 [his-72(promoter)::his-24::mCherry::let-858 3'UTR + unc-119(+)]. stIs10757 [alr-1::TGF(10A2)::GFP::TY1::3xFLAG inserted into fosmid WRM0617dE06 as C-terminal protein fusion]. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.]
RW10867 C. elegans unc-119(ed3) III; ltIs37 IV; stIs10116; stIs10867. Show Description
ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. stIs10116 [his-72(promoter)::his-24::mCherry::let-858 3'UTR + unc-119(+)]. stIs10867 [egl-5::TGF(7E3)::GFP::TY1::3xFLAG inserted into fosmid WRM0617dE06 as C-terminal protein fusion]. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.]
RW10868 C. elegans unc-119(ed3) III; ltIs37 IV; stIs10116; wgIs80. Show Description
ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. stIs10116 [his-72(promoter)::his-24::mCherry::let-858 3'UTR + unc-119(+)]. wgIs80 [eor-1::TGF(9G1)::GFP::TY1::3xFLAG inserted into fosmid WRM0617dE06 as C-terminal protein fusion]. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.]