| PHX945 |
C.elegans |
nish-1(syb767) IV; sybIs62. Show Description
sybIs62 [NISH-1::EGFP::3xFLAG + unc-119(+) + myo-2p::mCherry]. Transgene rescues nish-1(syb767) rilemenidine-induced longevity, rilemenidine-induced heat resistance, and rilemenidine-induced healthspan (body bends). Reference: Bennett DF, et al. Aging Cell. 2023 Feb;22(2):e13774. doi: 10.1111/acel.13774. PMID: 36670049.
|
|
| PQ530 |
C. elegans |
alg-1(ap423[3xflag::gfp::alg-1]) X. Show Description
alg-1(ap423 [3xflag::gfp::alg-1]) X. ALG-1 tagged at N-terminal with 3xFLAG:GFP at endogenous locus, verified by western blot and fluorescence microscopy. Reference: Aalto AP, et al. PLoS Genet. 2018 Jun 21;14(6):e1007379.
|
|
| PQ582 |
C. elegans |
alg-2(ap431[3xflag::mKate2::alg-2]) II. Show Description
alg-2(ap431[3xflag::mKate2::alg-2]) II. ALG-2 tagged at N-terminal with 3xFLAG:mKate2 at endogenous locus, verified by western blot and fluorescence microscopy. Reference: Aalto AP, et al. PLoS Genet. 2018 Jun 21;14(6):e1007379.
|
|
| PQ583 |
C. elegans |
alg-2(ap431[3xflag::mKate2::alg-2]) II; alg-1(ap423[3xflag::gfp::alg-1]) X. Show Description
alg-2(ap431[3xflag::mKate2::alg-2]) II. alg-1(ap423[3xflag::gfp::alg-1]) X. Derived from crossing PQ530 and PQ582 strains, verified by fluorescence microscopy. Reference: Aalto AP, et al. PLoS Genet. 2018 Jun 21;14(6):e1007379.
|
|
| PS10640 |
C. elegans |
cmk-1(sy2277[cmk-1::mKate2::AID*::3xFLAG) IV; syIs875. Show Description
syIs875 [ins-6p::dYFP + ins-6::mCherry + unc-122p::GFP]. cmk-1(sy2277) is a C-terminal knock-in of mKate2::AID*::FLAG to be used for conditional degradation of CMK-1 protein. sy2277 is a CRISPR-engineered allele generated using the self-excising cassette (SEC) method (Dickinson et al. 2015, Genetics) with the gRNA sequence 5'-AGCGTGAAAAGCGGGTGTAGNGG-3' (note: NGG not included in the gRNA). syIs875 is an integrated transgene that includes a transcriptional and translational reporter for ins-6 and is marked by GFP in the coelomocytes. dYFP signal can be seen in ASI during reproductive growth and in ASJ (strong) and ASI (weaker) during dauer exit. Reference: Zhang MG, et al. (2024). Available at: https://www.biorxiv.org/content/10.1101/2024.03.20.586022v1 [Accessed 13 August 2024].
|
|
| QP1961 |
C. elegans |
eaIs4. Show Description
eaIs4 [him-5p::him-5::GFP::3xFLAG::him-5 3'UTR + unc-119(+)]. Transgene recapitulates published HIM-5 expression patterns and can rescue high incidence of males phenotype of him-5 mutants. Reference: McClendon TB. et al. G3 (Bethesda). 2016 Dec 7;6(12):3913-3925. PMID 27678523.
|
|
| RAF2181 |
C. elegans |
ieSi57 II; daf-2(bch-40[AID*::3xFLAG::STOP::SL2::SV40::AID*::wrmScarlet::egl-13NLS]) unc-119(ed3) III. Show Description
ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. AID* tag inserted into endogenous daf-2 locus. ieSi57 is a single-copy transgene insertion into chromosome II (oxTi179) expressing modified Arabidopsis thaliana TIR1 tagged with mRuby in the soma. This strain can be used for auxin-inducible degradation (AID) of target proteins in somatic tissues. Reference: Venz R, et al. Elife. 2021 Sep 10;10:e71335. doi: 10.7554/eLife.71335. PMID: 34505574.
|
|
| RJP5269 |
C. elegans |
unc-31(rp166[GFP::TEV::AID*::FLAG::unc-31]) IV. Show Description
N-terminal GFP::TEV::AID*::FLAG tag inserted into endogenous unc-31 locus using CRISPR/Cas9. crRNA (TTTTCAGGAGGATCATGATT). Reference: Cornell R, et al. J Neurosci. 2022 Oct 26;JN-RM-1368-22. doi: 10.1523/JNEUROSCI.1368-22.2022. PMID: 36302635
|
|
| RJP5296 |
C. elegans |
reSi7 I; unc-31(rp166[GFP::TEV::AID*::FLAG::unc-31]) IV. Show Description
reSi7 [rgef-1p::TIR1::F2A::mTagBFP2::AID*::NLS::tbb-2 3'UTR] (I:-5.32). Neuronal-specific expression of TIR1 co-factor with N-terminal GFP::TEV::AID*::FLAG tag inserted into endogenous unc-31 locus using CRISPR/Cas9 can be used for conditional depletion of UNC-31 in the nervous system. crRNA (TTTTCAGGAGGATCATGATT). Reference: Cornell R, et al. J Neurosci. 2022 Oct 26;JN-RM-1368-22. doi: 10.1523/JNEUROSCI.1368-22.2022. PMID: 36302635. NOTE: PCR detection of reSi7 insert using the published primers has been reported to be defective. These primers designed by Sherlyn Wijaya and Claire Richardson to detect ttTi4338 (LG I) also work for reIs7: ttTi4338 (LG I) wrdSi23-F: cttcaaagaaatcgccgac wrdSi23-FP: AACAACGAGACCTACGTCG wrdSi23-R: Ctctaagatgtcggccac (wt ~300bp, mutant ~650bp).
|
|
| RP3510 |
C elegans |
trEx1010. Show Description
trEx1010 [pgp-14p::sms-5B(genomic)::Flag::mCherry + pgp-14p::YFP::pgp-14]. Pick animals with mCherry+ pharynx to maintain. Fluorescence is more apparent in older animals (late stage larvae to young adults). Generated in N2 background. Reference: Kamal M, et al. bioRxiv 2022.03.11.483951; doi: https://doi.org/10.1101/2022.03.11.483951.
|
|
| RW10312 |
C. elegans |
unc-119(tm4063) III; stIs10312. Show Description
stIs10312 [lim-7::TY1::EGFP::3xFLAG + unc-119(+)].
|
|
| RW10316 |
C. elegans |
unc-119(ed3) III; stIs10316. Show Description
stIs10316 [die-1::TY1::EGFP::3xFLAG + unc-119(+)].
|
|
| RW10325 |
C. elegans |
unc-119(ed3) III; stIs10325. Show Description
stIs10325 [mes-4::TY1::EGFP::3xFLAG + unc-119(+)].
|
|
| RW10348 |
C. elegans |
unc-119(ed3) III; ltIs37 IV; stIs10116; stIs10318. Show Description
ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. stIs10116 [his-72(promoter)::his-24::mCherry::let-858 3'UTR + unc-119(+)]. stIs10318 [nhr-25::TGF(3H4)::GFP::TY1::3xFLAG inserted into fosmid WRM0617dE06 as C-terminal protein fusion]. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.]
|
|
| RW10349 |
C. elegans |
unc-119(ed3) III; ltIs37 IV; stIs10116; stIs10311. Show Description
ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. stIs10116 [his-72(promoter)::his-24::mCherry::let-858 3'UTR + unc-119(+)]. stIs10311 [lin-39::TGF(3D3)::GFP::TY1::3xFLAG inserted into fosmid WRM0617dE06 as C-terminal protein fusion]. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.]
|
|
| RW10350 |
C. elegans |
unc-119(ed3) III; ltIs37 IV; stIs10116; stIs10309. Show Description
ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. stIs10116 [his-72(promoter)::his-24::mCherry::let-858 3'UTR + unc-119(+)]. stIs10309 [mab-5::TY1::eGFP::3xFLAG(P000007_E01)]. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.]
|
|
| RW10425 |
C. elegans |
unc-119(ed3) III; ltIs37 IV; stIs10116; stIs10389. Show Description
ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. stIs10116 [his-72(promoter)::his-24::mCherry::let-858 3'UTR + unc-119(+)]. stIs10389 [pha-4::TGF(3E3)::GFP::TY1::3xFLAG inserted into fosmid WRM0617dE06 as C-terminal protein fusion]. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.]
|
|
| RW10429 |
C. elegans |
unc-119(ed3) III; gaIs269. Show Description
gaIs269 [nhr-23::TY1::EGFP::3xFLAG + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in fosmid P000006_G11.
|
|
| RW10434 |
C. elegans |
unc-119(ed3) III; ltIs37 IV; stIs10116; stIs10394. Show Description
ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. stIs10116 [his-72(promoter)::his-24::mCherry::let-858 3'UTR + unc-119(+)]. stIs10394 [cnd-1::TGF(3C3)::GFP::TY1::3xFLAG inserted into fosmid WRM0617dE06 as C-terminal protein fusion]. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.]
|
|
| RW10455 |
C. elegans |
unc-119(ed3) III; stIs10455. Show Description
st10455 [elt-7::TY1::EGFP::3xFLAG + unc-119(+)].
|
|
| RW10470 |
C. elegans |
unc-119(ed3) III; stIs10470. Show Description
stIs10470 [tbx-8::TY1::EGFP::3xFLAG + unc-119(+)].
|
|
| RW10479 |
C. elegans |
unc-119(ed3) III; ltIs37 IV; stIs10116; stIs10426. Show Description
ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. stIs10116 [his-72(promoter)::his-24::mCherry::let-858 3'UTR + unc-119(+)]. stIs10426 [med-2::TGF(6.2B3)::GFP::TY1::3xFLAG inserted into fosmid WRM0617dE06 as C-terminal protein fusion]. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.]
|
|
| RW10481 |
C. elegans |
unc-119(ed3) III; ltIs37 IV; stIs10116; stIs10436. Show Description
ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. stIs10116 [his-72(promoter)::his-24::mCherry::let-858 3'UTR + unc-119(+)]. stIs10436 [hlh-1::TGF(6.2B4)::GFP::TY1::3xFLAG inserted into fosmid WRM0617dE06 as C-terminal protein fusion]. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.]
|
|
| RW10493 |
C. elegans |
unc-119(ed3) III; ltIs37 IV; stIs10116; stIs10472. Show Description
ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. stIs10116 [his-72(promoter)::his-24::mCherry::let-858 3'UTR + unc-119(+)]. stIs10472 [lin-11::TGF(7H3)::GFP::TY1::3xFLAG inserted into fosmid WRM0617dE06 as C-terminal protein fusion]. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.]
|
|
| RW10558 |
C. elegans |
unc-119(ed3) III; ltIs37 IV; stIs10116; stIs10470. Show Description
ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. stIs10116 [his-72(promoter)::his-24::mCherry::let-858 3'UTR + unc-119(+)]. stIs10470 [tbx-8::TGF(7G2)::GFP::TY1::3xFLAG inserted into fosmid WRM0617dE06 as C-terminal protein fusion]. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.]
|
|
| RW10560 |
C. elegans |
unc-119(ed3) III; ltIs37 IV; stIs10116; stIs10452. Show Description
ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. stIs10116 [his-72(promoter)::his-24::mCherry::let-858 3'UTR + unc-119(+)]. stIs10452 [lin-13::TGF(6.2B12)::GFP::TY1::3xFLAG inserted into fosmid WRM0617dE06 as C-terminal protein fusion]. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.]
|
|
| RW10563 |
C. elegans |
unc-119(ed3) III; stIs10563. Show Description
st10563 [glp-1::TY1::EGFP::3xFLAG + unc-119(+)].
|
|
| RW10702 |
C. elegans |
unc-119(ed3) III; stIs10702. Show Description
stIs10702 [hlh-6::TY1::EGFP::3xFLAG + unc-119(+)].
|
|
| RW10713 |
C. elegans |
unc-119(ed3) III; ltIs37 IV; stIs10116; stIs10485. Show Description
ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. stIs10116 [his-72(promoter)::his-24::mCherry::let-858 3'UTR + unc-119(+)]. stIs10485 [ttx-3::TGF(8G1)::GFP::TY1::3xFLAG inserted into fosmid WRM0617dE06 as C-terminal protein fusion]. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.]
|
|
| RW10714 |
C. elegans |
unc-119(ed3) III; ltIs37 IV; stIs10116; stIs10453. Show Description
ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. stIs10116 [his-72(promoter)::his-24::mCherry::let-858 3'UTR + unc-119(+)]. stIs10453 [elt-2::TGF(7E1)::GFP::TY1::3xFLAG inserted into fosmid WRM0617dE06 as C-terminal protein fusion]. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.]
|
|
| RW10726 |
C. elegans |
unc-119(ed3) III; ltIs37 IV; stIs10116; stIs10525. Show Description
ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. stIs10116 [his-72(promoter)::his-24::mCherry::let-858 3'UTR + unc-119(+)]. stIs10525 [ceh-14::TGF(8F2)::GFP::TY1::3xFLAG inserted into fosmid WRM0617dE06 as C-terminal protein fusion]. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.]
|
|
| RW10757 |
C. elegans |
unc-119(ed3) III; ltIs37 IV; stIs10116; stIs10757. Show Description
ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. stIs10116 [his-72(promoter)::his-24::mCherry::let-858 3'UTR + unc-119(+)]. stIs10757 [alr-1::TGF(10A2)::GFP::TY1::3xFLAG inserted into fosmid WRM0617dE06 as C-terminal protein fusion]. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.]
|
|
| RW10867 |
C. elegans |
unc-119(ed3) III; ltIs37 IV; stIs10116; stIs10867. Show Description
ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. stIs10116 [his-72(promoter)::his-24::mCherry::let-858 3'UTR + unc-119(+)]. stIs10867 [egl-5::TGF(7E3)::GFP::TY1::3xFLAG inserted into fosmid WRM0617dE06 as C-terminal protein fusion]. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.]
|
|
| RW10868 |
C. elegans |
unc-119(ed3) III; ltIs37 IV; stIs10116; wgIs80. Show Description
ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. stIs10116 [his-72(promoter)::his-24::mCherry::let-858 3'UTR + unc-119(+)]. wgIs80 [eor-1::TGF(9G1)::GFP::TY1::3xFLAG inserted into fosmid WRM0617dE06 as C-terminal protein fusion]. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.]
|
|
| RW10871 |
C. elegans |
unc-119(ed3) III; ltIs37 IV; stIs10116; wgIs87. Show Description
ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. stIs10116 [his-72(promoter)::his-24::mCherry::let-858 3'UTR + unc-119(+)]. wgIs87 [ceh-6::TGF(9H1)::GFP::TY1::3xFLAG inserted into fosmid WRM0617dE06 as C-terminal protein fusion]. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.]
|
|
| RW10913 |
C. elegans |
unc-119(ed3) III; ltIs37 IV; stIs10116; stIs10703. Show Description
ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. stIs10116 [his-72(promoter)::his-24::mCherry::let-858 3'UTR + unc-119(+)]. stIs10703 [ceh-26::TGF(10B1)::GFP::TY1::3xFLAG inserted into fosmid WRM0617dE06 as C-terminal protein fusion]. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.]
|
|
| RW10914 |
C. elegans |
unc-119(ed3) III; ltIs37 IV; stIs10116; wgIs108. Show Description
ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. stIs10116 [his-72(promoter)::his-24::mCherry::let-858 3'UTR + unc-119(+)]. wgIs108 [fkh-4::TGF(11D3)::GFP::TY1::3xFLAG inserted into fosmid WRM0617dE06 as C-terminal protein fusion]. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.]
|
|
| RW10993 |
C. elegans |
unc-119(ed3) III; ltIs37 IV; stIs10116; wgIs94. Show Description
ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. stIs10116 [his-72(promoter)::his-24::mCherry::let-858 3'UTR + unc-119(+)]. wgIs94 [pal-1::TY1::eGFP::3xFLAG(P000006_G02)]. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.]
|
|
| RW11144 |
C. elegans |
unc-119(ed3) III; ltIs37 IV; stIs10116; wgIs76. Show Description
ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. stIs10116 [his-72(promoter)::his-24::mCherry::let-858 3'UTR + unc-119(+)]. wgIs76 [unc-130::TY1::eGFP::3xFLAG(P000007_E01)]. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.]
|
|
| RW12180 |
C. elegans |
dxbp-1(st12180[dxbp-1::TY1::EGFP::3xFLAG]) I. Show Description
dxbp-1(st12180[dxbp-1::TY1::EGFP::3xFLAG]) I.
|
|
| RW12181 |
C. elegans |
egl-43(st12181[egl-43::TY1::EGFP::3xFLAG]) II. Show Description
egl-43(st12181[egl-43::TY1::EGFP::3xFLAG]) II.
|
|
| RW12185 |
C. elegans |
atg-4.1(st12185[atg-4.1::TY1::EGFP::3xFLAG]) I. Show Description
atg-4.1(st12185[atg-4.1::TY1::EGFP::3xFLAG]) I.
|
|
| RW12186 |
C. elegans |
tbx-38(st12186[tbx-38::TY1::EGFP::3xFLAG]) III. Show Description
tbx-38(st12186[tbx-38::TY1::EGFP::3xFLAG]) III.
|
|
| RW12187 |
C. elegans |
swsn-1(st12187[swsn-1::TY1::EGFP::3xFLAG]) V. Show Description
swsn-1(st12187[swsn-1::TY1::EGFP::3xFLAG]) V.
|
|
| RW12190 |
C. elegans |
nfyb-1(st12190[nfyb-1::TY1::EGFP::3xFLAG]) II. Show Description
nfyb-1(st12190[nfyb-1::TY1::EGFP::3xFLAG]) II.
|
|
| RW12194 |
C. elegans |
arid-1(st12194[arid-1::TY1::EGFP::3xFLAG]) V. Show Description
arid-1(st12194[arid-1::TY1::EGFP::3xFLAG]) V.
|
|
| RW12196 |
C. elegans |
egrh-3(st12196[egrh-3::TY1::EGFP::3xFLAG]) IV. Show Description
egrh-3(st12196[egrh-3::TY1::EGFP::3xFLAG]) IV.
|
|
| RW12201 |
C. elegans |
bed-1(st12201[bed-1::TY1::EGFP::3xFLAG]) V. Show Description
bed-1(st12201[bed-1::TY1::EGFP::3xFLAG]) V.
|
|
| RW12207 |
C. elegans |
ekl-4(st12207[ekl-4::TY1::EGFP::3xFLAG]) I. Show Description
ekl-4(st12207[ekl-4::TY1::EGFP::3xFLAG]) I.
|
|
| RW12208 |
C. elegans |
grh-1(st12208[grh-1::TY1::EGFP::3xFLAG]) I. Show Description
grh-1(st12208[grh-1::TY1::EGFP::3xFLAG]) I.
|
|