Strain Information
| Name | QK67 View On Wormbase |
|---|---|
| Species | C. elegans |
| Genotype | alg-1(xk5[3xFLAG::alg-1]) X. |
| Description | 3xFLAG tag inserted at N-terminus of short isoform of endogenous alg-1 locus. sgRNA #1: TATTGCGGCCCGCCGGACAT; sgRNA #2: TCAAACGACCCAATGTCCGG. Reference: Kotagama K, et al. Nucleic Acids Res. 2024 May 22;52(9):4985-5001. doi: 10.1093/nar/gkae170. PMID: 38471816. |
| Mutagen | Crispr/Cas9 |
| Outcrossed | x0 |
| Made by | Amelia Alessi |
| Laboratory | MCJ |
| Reference | Kotagama K, et al. Nucleic Acids Res. 2024 May 22;52(9):4985-5001. doi: 10.1093/nar/gkae170. PMID: 38471816. |
Sign in
or
register an account if you want to order this strain.