Strain Information

Name QK67   View On Wormbase
Species C. elegans
Genotypealg-1(xk5[3xFLAG::alg-1]) X.
Description3xFLAG tag inserted at N-terminus of short isoform of endogenous alg-1 locus. sgRNA #1: TATTGCGGCCCGCCGGACAT; sgRNA #2: TCAAACGACCCAATGTCCGG. Reference: Kotagama K, et al. Nucleic Acids Res. 2024 May 22;52(9):4985-5001. doi: 10.1093/nar/gkae170. PMID: 38471816.
MutagenCrispr/Cas9
Outcrossedx0
Made byAmelia Alessi
Laboratory MCJ
Reference Kotagama K, et al. Nucleic Acids Res. 2024 May 22;52(9):4985-5001. doi: 10.1093/nar/gkae170. PMID: 38471816.
Sign in or register an account if you want to order this strain.