Strain Information
| Name | RJP5296 View On Wormbase |
|---|---|
| Species | C. elegans |
| Genotype | reSi7 I; unc-31(rp166[GFP::TEV::AID::FLAG::unc-31]) IV. |
| Description | reSi7 [rgef-1p::TIR1::F2A::mTagBFP2::AID*::NLS::tbb-2 3'UTR] (I:-5.32). Neuronal-specific expression of TIR1 co-factor with N-terminal GFP::TEV::degran::FLAG tag inserted into endogenous unc-31 locus using CRISPR/Cas9 can be used for conditional depletion of UNC-31 in the nervous system. crRNA (TTTTCAGGAGGATCATGATT). Reference: Cornell R, et al. J Neurosci. 2022 Oct 26;JN-RM-1368-22. doi: 10.1523/JNEUROSCI.1368-22.2022. PMID: 36302635 |
| Mutagen | |
| Outcrossed | x2 |
| Made by | Roger Pocock |
| Laboratory | RJP |
| Reference | doi: 10.1523/JNEUROSCI.1368-22.2022 |
Sign in
or
register an account if you want to order this strain.