Strain Information
| Name | RJP5296 View On Wormbase |
|---|---|
| Species | C. elegans |
| Genotype | reSi7 I; unc-31(rp166[GFP::TEV::AID*::FLAG::unc-31]) IV. |
| Description | reSi7 [rgef-1p::TIR1::F2A::mTagBFP2::AID*::NLS::tbb-2 3'UTR] (I:-5.32). Neuronal-specific expression of TIR1 co-factor with N-terminal GFP::TEV::AID*::FLAG tag inserted into endogenous unc-31 locus using CRISPR/Cas9 can be used for conditional depletion of UNC-31 in the nervous system. crRNA (TTTTCAGGAGGATCATGATT). Reference: Cornell R, et al. J Neurosci. 2022 Oct 26;JN-RM-1368-22. doi: 10.1523/JNEUROSCI.1368-22.2022. PMID: 36302635. NOTE: PCR detection of reSi7 insert using the published primers has been reported to be defective. These primers designed by Sherlyn Wijaya and Claire Richardson to detect ttTi4338 (LG I) also work for reIs7: ttTi4338 (LG I) wrdSi23-F: cttcaaagaaatcgccgac wrdSi23-FP: AACAACGAGACCTACGTCG wrdSi23-R: Ctctaagatgtcggccac (wt ~300bp, mutant ~650bp). |
| Mutagen | |
| Outcrossed | x2 |
| Made by | Roger Pocock |
| Laboratory | RJP |
| Reference | doi: 10.1523/JNEUROSCI.1368-22.2022 |
Sign in
or
register an account if you want to order this strain.