Search Strains

umnIs64 [myo-2p::GFP + NeoR, II:12833878 (intergenic)] II. tmIn8 is a CRISPR/Cas9-induced inversion between F13D12.6 and cup-14 in LG II covering region (Mb) 2.1 (11.7..13.9). Derived by insertion of myo-2p::GFP transgene into parental strain FX19134 using CRISPR/Cas9.

umnIs65 [myo-2p::mKate2 + NeoR, V:4308261 (intergenic)] V. Derived by insertion of myo-2p::mKate2 transgene into parental strain N2 using CRISPR/Cas9.

umnIs66 [myo-2p::GFP + NeoR, II:12833878 (intergenic)] II. Derived by insertion of myo-2p::GFP transgene into parental strain N2 using CRISPR/Cas9.

umnIs67 [myo-2p::GFP + NeoR, I: 6284001 (intergenic)] III. Heterozygotes are WT GFP+ and segregate WT GFP+, DpyUnc, lethal GFP+ hT2 homozygotes (arrest stage unknown) and dead eggs (aneuploids). Will throw an occasional GFP+ Dpy non-Unc (similar events were observed in the parental hT2 strain). Pick WT GFP+ and check for correct segregation of progeny to maintain. Derived by insertion of myo-2p::GFP transgene into hT2 balancer in parental strain KR2467 using CRISPR/Cas9. [NOTE: 3/1995: Apparently the lethal mutation is closely linked but not within the balanced region of hT2. It can occasionally recombine away so that the strain will segregate Bli-4 hT2 homozygotes. (Mark Edgley)]

umnIs69 [myo-2p::GFP + NeoR, V:4308261(intergenic)] V. Break points: In(srbc-66 T10H9.8) V. Covered region (Mb) 3.1 (3.5..6.7). Derived by insertion of myo-2p::GFP transgene into parental strain FX19702 using CRISPR/Cas9.

umnIs70 [myo-2p::GFP + NeoR, X:6745526(intergenic)] X. tmIn26 homozygotes are Lon and Mec. Break points: In(lon-2 mec-10) X. Covered region (Mb) 3.7 (4.7..8.5) Lon Mec. Derived by insertion of myo-2p::GFP transgene into parental strain FX19171 using CRISPR/Cas9.

umnIs68 [myo-2p::GFP + NeoR, I:6284001(intergenic)] I. Break points: In(gsp-3 sre-23) I. Covered region (Mb) 3.5 (4.7..8.3). Derived by insertion of myo-2p::GFP transgene into parental strain FX19704 using CRISPR/Cas9.

umnIs72 [myo-2p::GFP + NeoR, I:6284001 (intergenic)] I. Derived by insertion of myo-2p::GFP transgene into parental strain N2 using CRISPR/Cas9.

umnIs73 [myo-2p::mKate2 + NeoR, III: 9421936 (intergenic)] I. Heterozygotes are WT mKate2+ and segregate WT mKate2+, DpyUnc, lethal mKate2+ hT2 homozygotes (arrest stage unknown) and dead eggs (aneuploids). Will throw an occasional mKate+ Dpy non-Unc (similar events were observed in the parental hT2 strain). Pick WT mKate2+ and check for correct segregation of progeny to maintain. Derived by insertion of myo-2p::mKate2 transgene into hT2 balancer in parental strain KR2467 using CRISPR/Cas9. [NOTE: 3/1995: Apparently the lethal mutation is closely linked but not within the balanced region of hT2. It can occasionally recombine away so that the strain will segregate Bli-4 hT2 homozygotes. (Mark Edgley)]

umnIs74 [myo-2p::mKate2 + NeoR, X: 15420938 (intergenic)] X. Derived by insertion of myo-2p::mKate2 transgene into parental strain N2 using CRISPR/Cas9.

umnIs75 [myo-2p::GFP + NeoR, I: 12541645 (intergenic)] I. Superficially wild-type. Crossover suppressor for LGI right. Inversion includes unc-75 and unc-54. Derived by insertion of myo-2p::GFP transgene into hIn1 inversion in parental strain KR1949 using CRISPR/Cas9.

umnIs76 [myo-2p::GFP + NeoR, V:4308261 (intergenic)] V. Derived by insertion of myo-2p::GFP transgene into parental strain N2 using CRISPR/Cas9.

umnIs77 [myo-2p::mKate2 + NeoR, I: 6284001 (intergenic)] X. Heterozygotes are wild-type mKate2+, and segregate wild-type mKate2+, DpyUnc non-mKate2, dead eggs and mKate2+ Lon males. Maintain by picking wild-type mKate2+. Derived by insertion of myo-2p::mKate2 transgene into szT1 balancer in parental strain AF1 using CRISPR/Cas9.

Viable and fertile. Deletion of 664 bp, molecular null.

Heterozygotes are WT and segregate WT, Dpy Steriles and 3-fold lethals. cg46 is a 497 bp deletion that removes the last 22 nucleotides of intron 9 and 475 nucleotides of exon 10;

Parental strain was CH1416 mut-2(r459) I; nid-1(ev608) V. Tc1 excision deletion of nid-1 was identified. In frame deletion, removes amino acids Thr53-Gln693 of NID-1. Homozygous viable and fertile, slightly reduced fertility. mut-2 was removed by outcrossing. nid-1=F54F3.1. Received new stock 1/2004 from Jim Kramer.

Parental strain was CH1416 mut-2(r459) I; nid-1(ev608) V. Tc1 excision deletion of nid-1 was identified. Molecular null, deletion removes promoter region. Homozygous viable and fertile, fecundity reduced by approximately 30%. nid-1=F54F3.1.

Homozygous viable and fertile. Partially penetrant Egl and cell/axon guidance defects. Deletion of nucleotides 22756-24758 based on cosmid F39H11 sequence (Genbank AF164959). Results in loss of carboxyl NC1 domain from CLE-1.

Superficially wild-type. 2366 bp deletion (965-3330 of U41266(EGAP1)) caused by imprecise excision of Tc1. Deletion can be detected by PCR with primers DSP4 (AATTAGTTGACGAGACAAGTCAGG) and B3 (AGTGAAGGCAGAATGTACTCC) --306 kb WT vs 1.2 kb mutant.

Animals commonly have a protruding vulva. Unc (slow moving and non-sinusoidal body posture). Egl. Ectopic surface binding of the lectins WGA and SBA. Males are infertile and Mab-crumpled spicules and abnormal rays and lack diagonal sex muscles.

dvIs3 [unc-54p::human transthyretin + rol-6(su1006)]. Rollers. Him. Expression of wild-type human transthyretin (TTR) in body wall muscles. Transthyretin is secreted from the muscles into the pseudocoelom and concentrates in the coelomocytes. Reference: Link CD (1995) Proc Natl Acad Sci U S A 92:9368-9372.

dvIs70 [hsp-16.2p::GFP + rol-6(su1006)]. Roller. Integrated array containg pCL25 (hsp-16-2 promoter/GFP transcriptional fusion) and pRF4. Shows robust induction of GFP expression after heat induction. Not known where dvIs70 is integrated.

Animals are somewhat smaller than WT and commonly have a protruding vulva. Unc(slow moving and non-sinusoidal body posture). Egl. Ectopic surface binding of the lectins WGA and SBA. Males are infertile and Mab.

dvIs14 [(pCL12) unc-54::beta 1-42 + (pCL26) mtl-2::GFP]. mtl-2::GFP produces strong constitutive intestinal expression of GFP at all developmental stages. Expresses human AB peptide and accumulates B-amyloid fibrils. AB toxicity enhanced at higher temperatures.

dvIs179 [myo-3p::GFP::3' UTR(long) + rol-6(su1006)]. Maintain at 16C. Superficially wild-type Roller; expression of GFP in body wall muscles increases with temperature. References: Link CD, et al. (2006) J Biol Chem. Jan 20;281(3):1808-16. Hassan WM, et al. (2014) Neurobiology of Aging. [NOTE: The temperature-sensitive allele cc546 causes an M1957L change in SMG-1. The lesion is an atg>ttg transversion in exon 35. Flanking sequences follow with the mutation site indicated with a capital A: ttggtggtcggttacaaaacgatattcaaga tcactggcagtcatgagtAtggttggatcagttttaggactcggtgatcg acatttggacaatttattg The lesion is detectable via SNP-snip with the mutation causing loss of an MslI site. Primers are for a 323 bp product. Digest with MslI to 86+237 in the wild type, uncut as 323 in the mutant. DJR701(f): CAGTCGTGAGCTTTGGATGCGTGC DJR702(r): TCGGGGATACGCAGATTCTTTCCC. Pedone ... Reiner G3 (2021).]

dvIs37 [myo-3p::GFP::A-Beta (3-42) + rol-6(su1006)]. Maintain at 16C. Roller. Diffuse and aggregated GFP expression in body wall muscle. Low brood size. Sicker at higher temperatures (e.g. 25C). Reference: Link CD, et al. (2008) Neurobiology of Disease,32(3):420-5.

dvIs38 [myo-3p::GFP::degron::3' UTR(long) + rol-6(su1006)]. Maintain at 16C. Rollers. Temperature-dependent expression of aggregating GFP in body wall muscle (weak at 16C, strong at 25C). Animals become paralyzed if upshifted as larvae to 25C due to expression of aggregating GFP. References: Link CD, et al. (2006) J Biol Chem. Jan 20;281(3):1808-16. Hassan WM, et al. (2014) Neurobiology of Aging. [NOTE: The temperature-sensitive allele cc546 causes an M1957L change in SMG-1. The lesion is an atg>ttg transversion in exon 35. Flanking sequences follow with the mutation site indicated with a capital A: ttggtggtcggttacaaaacgatattcaaga tcactggcagtcatgagtAtggttggatcagttttaggactcggtgatcg acatttggacaatttattg The lesion is detectable via SNP-snip with the mutation causing loss of an MslI site. Primers are for a 323 bp product. Digest with MslI to 86+237 in the wild type, uncut as 323 in the mutant. DJR701(f): CAGTCGTGAGCTTTGGATGCGTGC DJR702(r): TCGGGGATACGCAGATTCTTTCCC. Pedone ... Reiner G3 (2021).]

dvIs50 [pCL45 (snb-1::Abeta 1-42::3' UTR(long) + mtl-2::GFP] I. Maintain at 16C. Pan-neuronal expresion of human Abeta peptide. Constitutive intestinal expression of GFP from marker transgene. Strain shows deficits in chemotaxis, associative learning, and thrashing in liquid. Strain also has incomplete sterility due to germline proliferation defects and embryonic lethality. Maintain at 16 C to reduce selection against transgene, although this does not alter the partial sterility. Reference: Wu Y., et al. J Neurosci. 2006 Dec 13;26(50):13102-13. [NOTE: The temperature-sensitive allele cc546 causes an M1957L change in SMG-1. The lesion is an atg>ttg transversion in exon 35. Flanking sequences follow with the mutation site indicated with a capital A: ttggtggtcggttacaaaacgatattcaaga tcactggcagtcatgagtAtggttggatcagttttaggactcggtgatcg acatttggacaatttattg The lesion is detectable via SNP-snip with the mutation causing loss of an MslI site. Primers are for a 323 bp product. Digest with MslI to 86+237 in the wild type, uncut as 323 in the mutant. DJR701(f): CAGTCGTGAGCTTTGGATGCGTGC DJR702(r): TCGGGGATACGCAGATTCTTTCCC. Pedone ... Reiner G3 (2021).]

WT except for ectopic surface binding of wheat germ agglutinin (WGA).

dvIs75 [myo-3::Abeta 1-42 G37L::3' UTR(long) + mtl-2::GFP)]. Temperature-inducible induction of human Abeta peptide in body wall muscle; paralysis in ~32 hr if induced as L3 larvae. Maintain at 16 C to prevent strong Abeta induction and larval paralysis/arrest. Reference: Fonte V., et al. Mol Neurodegener. 2011 Aug 23;6(1):61. [NOTE: The temperature-sensitive allele cc546 causes an M1957L change in SMG-1. The lesion is an atg>ttg transversion in exon 35. Flanking sequences follow with the mutation site indicated with a capital A: ttggtggtcggttacaaaacgatattcaaga tcactggcagtcatgagtAtggttggatcagttttaggactcggtgatcg acatttggacaatttattg The lesion is detectable via SNP-snip with the mutation causing loss of an MslI site. Primers are for a 323 bp product. Digest with MslI to 86+237 in the wild type, uncut as 323 in the mutant. DJR701(f): CAGTCGTGAGCTTTGGATGCGTGC DJR702(r): TCGGGGATACGCAGATTCTTTCCC. Pedone ... Reiner G3 (2021).]

Animals are somewhat smaller than WT. Often have protuding vulva. Unc(slow moving and non-sinusoidal body posture). Egl. Males are infertile and Mab. Ectopic surface binding of lectins WGA and SBA.

dvIs770 [myo-3::Abeta 1-42 wt::3' UTR(long) + mtl-2::GFP]. Maintain at 16 C to prevent strong Abeta induction and larval paralysis/arrest. Temperature-inducible induction of human Abeta peptide in body wall muscle; paralysis in 18-24 hr if induced as L3 larvae. NOTE: dvIs770 was originally described as dvIs70 in Fonte et al, 2011. The name of this array was changed to dvIs770 to avoid confusion with dvIs70 [hsp-16.2p::GFP + rol-6(su1006)] carried in strain CL2070. Reference: Fonte V., et al. Mol Neurodegener. 2011 Aug 23;6(1):61. [NOTE: The temperature-sensitive allele cc546 causes an M1957L change in SMG-1. The lesion is an atg>ttg transversion in exon 35. Flanking sequences follow with the mutation site indicated with a capital A: ttggtggtcggttacaaaacgatattcaaga tcactggcagtcatgagtAtggttggatcagttttaggactcggtgatcg acatttggacaatttattg The lesion is detectable via SNP-snip with the mutation causing loss of an MslI site. Primers are for a 323 bp product. Digest with MslI to 86+237 in the wild type, uncut as 323 in the mutant. DJR701(f): CAGTCGTGAGCTTTGGATGCGTGC DJR702(r): TCGGGGATACGCAGATTCTTTCCC. Pedone ... Reiner G3 (2021).]

dvIs27 [myo-3p::A-Beta (1-42)::let-851 3'UTR) + rol-6(su1006)] X. Rollers. Temperature sensitive: needs to be propagated at 15C. Upshift larval animals to check that the worms get paralyzed and give offspring that arrest as eggs/early larvae. This strain produces low levels of beta amyloid peptide even when grown at low temperature, and therefore there is always some selection for loss of transgene copies. It is recommended to maintain growing stock plates at 15-16 degrees C by transferring small numbers of animals each generation rather than by "chunking", which increases the effective population size and therefore the chance of a relatively rare transgene loss, and then this revertant taking over the population. The strain should also be frozen shortly after being received. This strain can only be sent to academic users and not to commercial organizations. [NOTE: The temperature-sensitive allele cc546 causes an M1957L change in SMG-1. The lesion is an atg>ttg transversion in exon 35. Flanking sequences follow with the mutation site indicated with a capital A: ttggtggtcggttacaaaacgatattcaaga tcactggcagtcatgagtAtggttggatcagttttaggactcggtgatcg acatttggacaatttattg The lesion is detectable via SNP-snip with the mutation causing loss of an MslI site. Primers are for a 323 bp product. Digest with MslI to 86+237 in the wild type, uncut as 323 in the mutant. DJR701(f): CAGTCGTGAGCTTTGGATGCGTGC DJR702(r): TCGGGGATACGCAGATTCTTTCCC. Pedone ... Reiner G3 (2021).]

dvIs19 [(pAF15) gst-4p::GFP::NLS] III. dvIs27 [myo-3p::A-Beta (1-42)::let-851 3'UTR) + rol-6(su1006)] X. Roller with weak constitutive GFP expression. Balanced strain, segregates Rol Uncs [skn-1(zu67) heterozygotes], Rol nonUncs [skn-1(zu67) homozygotes] and dead eggs. Maintain by picking Rol Uncs. Paralyzed if upshifted as larvae to 25C. References: Dostal, V and Link CD (2010) J Vis Exp. Oct 9;(44). Dostal V, Roberts CM, Link CD (2010) Genetics Nov;186(3):857-66. [NOTE: The temperature-sensitive allele cc546 causes an M1957L change in SMG-1. The lesion is an atg>ttg transversion in exon 35. Flanking sequences follow with the mutation site indicated with a capital A: ttggtggtcggttacaaaacgatattcaaga tcactggcagtcatgagtAtggttggatcagttttaggactcggtgatcg acatttggacaatttattg The lesion is detectable via SNP-snip with the mutation causing loss of an MslI site. Primers are for a 323 bp product. Digest with MslI to 86+237 in the wild type, uncut as 323 in the mutant. DJR701(f): CAGTCGTGAGCTTTGGATGCGTGC DJR702(r): TCGGGGATACGCAGATTCTTTCCC. Pedone ... Reiner G3 (2021).]

dvIs19 [(pAF15) gst-4p::GFP::NLS] III. Oxidative stress-inducible GFP. Segregates Unc skn-1(zu67) heterozygotes, arrested eggs/larvae (nT1 homozygotes), and wild type skn-1(zu67) homozygotes (sterile). All genotypes show constitutive weak GFP expression. Upon exposure to SKN-1 inducers (e.g., azide), strong induction of GFP is observered in skn-1/+ hets; there is no induction in skn-1 homozygotes. Pick Uncs to maintain -- although this strain is nominally balanced, nT1 can break down. Reference: Dostal, V., et al. Genetics. 2010 Nov;186(3):857-66.

Rollers. Maintain under normal conditions. Standard control for CL4176; originally used CL1175 as the control, but subsequently it was found that CL1175 can produce some A-Beta. Reference: Fonte V., et al. Mol Neurodegener. 2011 Aug 23;6(1):61. [NOTE: The temperature-sensitive allele cc546 causes an M1957L change in SMG-1. The lesion is an atg>ttg transversion in exon 35. Flanking sequences follow with the mutation site indicated with a capital A: ttggtggtcggttacaaaacgatattcaaga tcactggcagtcatgagtAtggttggatcagttttaggactcggtgatcg acatttggacaatttattg The lesion is detectable via SNP-snip with the mutation causing loss of an MslI site. Primers are for a 323 bp product. Digest with MslI to 86+237 in the wild type, uncut as 323 in the mutant. DJR701(f): CAGTCGTGAGCTTTGGATGCGTGC DJR702(r): TCGGGGATACGCAGATTCTTTCCC. Pedone ... Reiner G3 (2021).]

twn16 is a 1651 bp deletion removing 1027 bp of the promoter sequence, the transcriptional start site, and the first two exons of pmp-4. Superficially wild-type. Normal dauer formation. Reference: Tsai SH, et al. Cell Rep. 2024 Mar 22;43(4):113996. doi: 10.1016/j.celrep.2024.113996. PMID: 38520690.

twnEx656 [pmp-4p::pmp-4 + elt-2p::GFP]. Pick GFP+ animals to maintain. Superficially wild-type. twnEx656 contains 1.2 kb pmp-4 promoter driving expression of 2.2 kb pmp-4 cDNA; transgene rescues behavioral phenotype of twn16 mutants. twn16 is a 1651 bp deletion removing 1027 bp of the promoter sequence, the transcriptional start site, and the first two exons of pmp-4. twn16 has been out-crossed 3 times in this strain. Reference: Tsai SH, et al. Cell Rep. 2024 Mar 22;43(4):113996. doi: 10.1016/j.celrep.2024.113996. PMID: 38520690.

twnEx185 [mec-7p::MTS::roGFP + mec-7p::TOMM20::mCherry + ttx-3p::GFP]. Pick animals with GFP expression in head neurons (AIY) to maintain. roGFP can be used to monitor redox status of the mitochondrial matrix in the six touch receptor neurons: the oxidation-reduction status of mitochondrial matrix can be monitored with roGFP, a GFP variant that increases brightness in a more oxidized environment. The mitochondrial outer membrane in these neurons are marked by mCherry. Reference: Jiang HC, et al. Proc Natl Acad Sci USA. 2015 Jul 14;112(28):8768-73. doi: 10.1073/pnas.1501831112. PMID: 26124107. [NOTE: twnEx185 is incorrectly described as carrying myo-2p::GFP in the reference publication. The correct co-injection marker is ttx-3::GFP.]

Increased movement quiescence during lethargus. knu568 is a specific in-frame deletion of the TSP1 domain. Reference: Sinner MP, et al. Curr Biol. 2021 Feb 8;31(3):564-577.e12. PMID: 33259791

Specific in-frame deletion of the astacin domain in ok3407 background suppresses increased quiescence from the ok3407 allele. Quiescence behavior in this strain is reverted to wild-type. Reference: Sinner MP, et al. Curr Biol. 2021 Feb 8;31(3):564-577.e12. PMID: 33259791

knu858 is a Y146C point mutation representative of a patient mutation associated with MPSIIIB disease. This strain may not be distributed to commercial or for-profit entities. Please contact ethan@perlara.com for more information.

oaSi41 [par-5p::GFP::par-5::par-5 3' UTR.2(prespliced) + unc-119(+)] II. MOS single copy insertion of PAR-5 under control of the PAR-5 3'UTR.2 isoform exclusively. Reference: Mikl, M. and Cowan, CR. Cell Rep. 2014 Sep 11;8(5):1380-90.

mCherry tag inserted at the C-terminus of the endogenous spin-1 locus via CRISPR/Cas9 engineering. This strain may not be distributed to commercial or for-profit entities without prior written permission from In Vivo Biosystems. Please contact support@invivobiosystems.com for more information. Reference: Villalobos TV, et al. Nat Aging. 2023 Sep;3(9):1091-1106. PMID: 37580394.

mCherry tag inserted at the C-terminus of the endogenous spin-2 locus via CRISPR/Cas9 engineering. This strain may not be distributed to commercial or for-profit entities without prior written permission from In Vivo Biosystems. Please contact support@invivobiosystems.com for more information. Reference: Villalobos TV, et al. Nat Aging. 2023 Sep;3(9):1091-1106. PMID: 37580394.

mCherry tag inserted at the C-terminus of the endogenous spin-3 locus via CRISPR/Cas9 engineering. This strain may not be distributed to commercial or for-profit entities without prior written permission from In Vivo Biosystems. Please contact support@invivobiosystems.com for more information. Reference: Villalobos TV, et al. Nat Aging. 2023 Sep;3(9):1091-1106. PMID: 37580394.

mCherry tag inserted at the C-terminus of the endogenous spin-4 locus via CRISPR/Cas9 engineering. This strain may not be distributed to commercial or for-profit entities without prior written permission from In Vivo Biosystems. Please contact support@invivobiosystems.com for more information. Reference: Villalobos TV, et al. Nat Aging. 2023 Sep;3(9):1091-1106. PMID: 37580394.

knu1099 is an engineered 7437 bp deletion in spin-4. Flanking sequences immediately outside of the region deleted ares: 5′ flank (forward strand), 5′- GTT CGG TGG AGC GCG CCT GCG -3’; 3′ flank (reverse strand), 5′- GTC TGT GTT GCT GTT CCT CAT -3’. In between these flanking sequences, a three-frame stop as well as a unique primer-binding sequence were inserted in place of the deleted sequence. This strain may not be distributed to commercial or for-profit entities without prior written permission from In Vivo Biosystems. Please contact support@invivobiosystems.com for more information. Reference: Flora Y & Bohnert KA. Dev Biol. 2023 Dec:504:137-148. doi: 10.1016/j.ydbio.2023.09.013. PMID: 37805103.

knu1284 is a CRISPR-engineered in-frame deletion of the TZF domain of oma-1. AID* degron tag (IAA17) inserted into the endogenous oma-2 locus. When OMA-2 is present, this mutant does not appear to have obvious phenotypes. Auxin-inducible depletion of OMA-2 causes a null phenotype: animals do not produce mature embryos and have an empty uterus. Reference: Ertekin A, et al. bioRxiv. 2025 May 12:2025.05.09.653132. doi: 10.1101/2025.05.09.653132. PMiD: 40463014.

Larval-lethal puf-2 deletion allele. Heterozygotes are WT (slightly Dpy) and segregate 25% Dpy, 50% wild-type heterozygotes, and 25% larval lethal (arrest L1-L2). Maintain by picking WT and checking for correct segregation of progeny. Map distance between nm4 and nm66 has not been preciely determined, but is tight enough that >90% of non-Dpy non-Lva progeny from double-heterozygotes retain the parental genotype. Reference: Liu Q & Haag ES. J Exp Zool. 2013 Part B.