Caenorhabditis Genetics Center (CGC)

More Fields
Strain Species Genotype
CH1315 C. elegans zmp-1(cg115) III. Show Description
Superficially wild-type. 2366 bp deletion (965-3330 of U41266(EGAP1)) caused by imprecise excision of Tc1. Deletion can be detected by PCR with primers DSP4 (AATTAGTTGACGAGACAAGTCAGG) and B3 (AGTGAAGGCAGAATGTACTCC) --306 kb WT vs 1.2 kb mutant.
NK2964 C. elegans nifk-1(qy126[nifk-1::mNG]) zmp-1(cg115) III. Show Description
mNG tag inserted into the C-terminus of the endogenous nifk-1 locus.