Strain Information

Name CH1315   View On Wormbase
Species C. elegans
Genotypezmp-1(cg115) III.
DescriptionSuperficially wild-type. 2366 bp deletion (965-3330 of U41266(EGAP1)) caused by imprecise excision of Tc1. Deletion can be detected by PCR with primers DSP4 (AATTAGTTGACGAGACAAGTCAGG) and B3 (AGTGAAGGCAGAATGTACTCC) --306 kb WT vs 1.2 kb mutant.
MutagenTc1 Excision
Outcrossedx7
Made byJames Kramer
Laboratory CH
Sign in or register an account if you want to order this strain.