Strain Information
| Name | CH1315 View On Wormbase |
|---|---|
| Species | C. elegans |
| Genotype | zmp-1(cg115) III. |
| Description | Superficially wild-type. 2366 bp deletion (965-3330 of U41266(EGAP1)) caused by imprecise excision of Tc1. Deletion can be detected by PCR with primers DSP4 (AATTAGTTGACGAGACAAGTCAGG) and B3 (AGTGAAGGCAGAATGTACTCC) --306 kb WT vs 1.2 kb mutant. |
| Mutagen | Tc1 Excision |
| Outcrossed | x7 |
| Made by | James Kramer |
| Laboratory | CH |
Sign in
or
register an account if you want to order this strain.