More Fields
Strain Species Genotype
CL2621 C. elegans smg-1(cc546) I; dvIs75. Show Description
dvIs75 [myo-3::Abeta 1-42 G37L::3' UTR(long) + mtl-2::GFP)]. Temperature-inducible induction of human Abeta peptide in body wall muscle; paralysis in ~32 hr if induced as L3 larvae. Maintain at 16 C to prevent strong Abeta induction and larval paralysis/arrest. Reference: Fonte V., et al. Mol Neurodegener. 2011 Aug 23;6(1):61. [NOTE: The temperature-sensitive allele cc546 causes an M1957L change in SMG-1. The lesion is an atg>ttg transversion in exon 35. Flanking sequences follow with the mutation site indicated with a capital A: ttggtggtcggttacaaaacgatattcaaga tcactggcagtcatgagtAtggttggatcagttttaggactcggtgatcg acatttggacaatttattg The lesion is detectable via SNP-snip with the mutation causing loss of an MslI site. Primers are for a 323 bp product. Digest with MslI to 86+237 in the wild type, uncut as 323 in the mutant. DJR701(f): CAGTCGTGAGCTTTGGATGCGTGC DJR702(r): TCGGGGATACGCAGATTCTTTCCC. Pedone ... Reiner G3 (2021).]