Search Strains

Heterozygotes are WT and segregate WT, Steriles with an Everted Vul and DpyUncs. Do not distribute this strain; other labs should request it from the CGC.

Heterozygotes are WT and segregate WT, DpyUncs and Steriles which have an everted Vulva. CGC rec'd new stock from Iva Greenwald 5/2000. The unc-85 dpy-10 chromosome had been lost from this stock; for some reason it was difficult to maintain as a heterozygote. Do not distribute this strain; other labs should request it from the CGC.

Heterozygotes are WT (Dpyish) and segregate WT (Dpyish), DpyUncs and Steriles which have an everted vulva. Do not distribute this strain; other labs should request it from the CGC.

Heterozygotes are WT and segregate WT, DpyUncs and Steriles which have an everted vulva. Throws males. Do not distribute this strain; other labs should request it from the CGC.

Heterozygotes are WT and segregate WT, DpyUncs and Sterile Unc-36 which have an everted vulva. Do not distribute this strain; other labs should request it from the CGC.

arIs82 [lin-12::GFP + egl-17p::lacZ + unc-4(+)]. Reference: Shaye DD, Greenwald I. Nature. 2002 Dec 12;420(6916):686-90. Do not distribute this strain; other labs should request it from the CGC.

Heterozygotes are WT and segregate WT, DpyUncs and Steriles which have an everted vulva. Do not distribute this strain; other labs should request it from the CGC.

Heterozygotes are WT and segregate WT, DpyUncs and Steriles which have an everted vulva. Do not distribute this strain; other labs should request it from the CGC.

arIs41 [lin-12::GFP + rol-6(su1006)]. Rollers. Reference: Levitan D, Greenwald I. Development. 1998 Aug;125(16):3101-9. Do not distribute this strain; other labs should request it from the CGC.

Heterozygotes are Unc and segregate Uncs, dead eggs, and Egl. lin-25(ar90) is a probable null mutation. Hermaphrodites are completely unable to lay eggs. Lineage defects in VPCs. Amber mutation (codon 197); amber suppressable. Do not distribute this strain; other labs should request it from the CGC.

Heterozygotes are WT and segregate WT, DpyUncs and Steriles which have an everted vulva. Do not distribute this strain; other labs should request it from the CGC.

Heterozygotes are WT and segregate WT, Uncs and Sterile Dpys which have an everted vulva. Do not distribute this strain; other labs should request it from the CGC.

Heterozygotes are WT and segregate WT, Uncs and DpySteriles with an everted vulva. Recombines. Do not distribute this strain; other labs should request it from the CGC.

arIs98 [apx-1p::2xNLS::YFP + ceh-22p::GFP + dpy-20(+)]. References: Li J, Greenwald I. Curr Biol. 2010 Oct 26;20(20):1875-9. Karp X, Greenwald I. Proc Natl Acad Sci USA. 2013 Feb 5;110(6):2181-6. Do not distribute this strain; other labs should request it from the CGC.

arIs131 [lag-2p::2xNLS::YFP + ceh-22p::GFP + pha-1(+)] III. References: Li J, Greenwald I. Curr Biol. 2010 Oct 26;20(20):1875-9. Zhang X, Greenwald I. Genetics. 2011 Aug;188(4):847-58. Do not distribute this strain; other labs should request it from the CGC.

arIs116 [lst-5p::2xNLS::YFP + ttx-3p::GFP + pha-1(+)] X. References: Li J, Greenwald I. Curr Biol. 2010 Oct 26;20(20):1875-9. Karp X, Greenwald I. Proc Natl Acad Sci USA. 2013 Feb 5;110(6):2181-6. Do not distribute this strain; other labs should request it from the CGC.

Heterozygotes are Unc and segregate Uncs, dead eggs, and Egl. lin-25(sy29) is a non-null allele. Hermaphrodites are 100% Egl but some eggs are seen on plates. Results from a missense mutation in codon 103. Do not distribute this strain; other labs should request it from the CGC.

Unc. Temperature sensitive hypomorphic lin-12 allele. At restrictive temperature of 25C: 100% Egl in unc-32 background (95% Egl without unc-32); 30% have 2 anchor cells, some proximal mitosis, abnormal vulval lineages but has opening; leaks some eggs; mates with males. At permissive temperature of 15C: 93% Egl(+) and 7% Egl(-) [lin-12(d)-like: no anchor cell and no vulval opening]. Do not distribute this strain; other labs should request it from the CGC.

arIs107 [mir-61p::2xNLS::YFP + ttx-3p::GFP + pha-1(+)]. References: Yoo AS, Greenwald I. Science. 2005 Nov 25;310(5752):1330-3. Do not distribute this strain; other labs should request it from the CGC.

Unc. At 25C ar39 recessively suppresses the Egl phenotype of n676n930. At 15C a high percentage of hermaphrodites have a 0 AC-Egl phenotype. ar39 recessively suppresses vulval lineage defects and proximal mitosis. Do not distribute this strain; other labs should request it from the CGC.

RollerUnc. At 25C e1948 recessively suppresses the Egl phenotype of n676n930. At 15C a high percentage of hermaphrodites have a 0 AC-Egl phenotype. e1948 recessively suppresses vulval lineage defects and proximal mitosis. sc8 previously called rol-4(sc8). See also WBPaper00002448. Do not distribute this strain; other labs should request it from the CGC.

Long. Unc. At 15C ar41 suppresses the 2 AC (anchor cell) phenotype of n676n930. (Strain GS878 does not contain sel(arX) and therefore does not suppress the Egl phenotype at 25C.) See also WBPaper00002966. Do not distribute this strain; other labs should request it from the CGC.

DpyUnc. ar40 is a semi-dominant suppressor. At 25C ar40 suppresses the Egl phenotype of ne676n930. At 15C a high percentage of hermaphrodites have a 0 AC-Egl phenotype. ar40 suppresses proximal mitosis. ar40 does not suppress vulval lineage defects. Do not distribute this strain; other labs should request it from the CGC.

Heterozygotes are Unc and segregate Unc, dead eggs and lethal Twitchers. Lethal early larval (L1-L2). Maintain by picking Unc. Do not distribute this strain; other labs should request it from the CGC.

gwIs39 [baf-1::gfp-lacI::let-858 3'UTR + vit-5::GFP] III. bqSi225 [emr-1p::emr-1::mCherry + unc-119(+)] IV. gwIs59 [pha-4::mCherry::256xLacO::4xLexA + unc-119(+)]. Superficially wild-type. Express ubiquitous EMR-1::mCherry at the nuclear periphery. Expresses GFP-LacI from early embryogenesis and throughout development, which forms a small spot at the lacO array. Worms have red intestine (all stages) and green intestine (from late L4 stage). Reference: Harr JC, et al. Genes Dev. 2020 Apr 1;34(7-8):560-579. PMID: 32139421.

gwIs4 [myo-3p::RFP + baf-1::GFP-lacI:::let-858 3'UTR] X. Worms are slow growing, with reduced brood size and become sterile at elevated temperatures. Expresses GFP-LacI from early embryogenesis and throughout development, which forms a small spot at the lacO array. RFP expression in muscles. Reference: Gonzalez-Sandoval A, et al. Cell. 2015 Dec 3;163(6):1333-47. doi: 10.1016/j.cell.2015.10.066. PMID: 26607792.

gwIs39 [baf-1::gfp-lacI::let-858 3'UTR + vit-5::GFP] III. gwIs34 [myo-3::mCherry + 256xlacO + unc-119(+)] III. Superficially wild-type. Expresses GFP-LacI throughout development from early embryogenesis, forming a small spot at the lacO array. Worms have red muscle (from L1 stage) and green intestine (from late L4 stage). Reference: Meister P, et al. Genes Dev. 2010 Apr 15;24(8):766-82. PMID: 20395364

gwIs39 [baf-1::gfp-lacI::let-858 3'UTR + vit-5::GFP] III. gwIs58 [hsp-16.2p::mCherry::256xLacO::4xLexA + unc-119(+)]. Small transgene/large array. Superficially wild-type. Expresses GFP-LacI from early embryogenesis and throughout development, which forms a small spot at the lacO array. Worms have green intestine (from late L4 stage). Might still carry unc-119(ed3) in background. Reference: Rohner S, et al. J Cell Biol. 2013 Mar 4;200(5):589-604. doi: 10.1083/jcb.201207024. PMID: 23460676

gwIs39 [baf-1::gfp-lacI::let-858 3'UTR + vit-5::GFP] III. ygIs2 [baf-1::GFP::lmn-1(Y59C) + unc-119(+)]. caIs3 [pha-4::lacZ + rol-6(su1006)]. Rollers. Strain expressing low level of GFP::LMN-1 (carrying the Y59C mutation). Expresses GFP-LacI from early embryogenesis and throughout development, which forms a small spot at the lacO array. Worms have red muscle (from L1 stage) and green intestine (from late L4 stage). Reference: Mattout A, et al. Curr Biol. 2011 Oct 11;21(19):1603-14. doi: 10.1016/j.cub.2011.08.030. PMID: 21962710

gwIs39 [baf-1::gfp-lacI::let-858 3'UTR + vit-5::GFP] III. gwIs4 [baf-1p::GFP-lacI::let-858 3’UTR + myo-3p::RFP] X. Superficially wild-type. Expresses GFP-LacI throughout development from early embryogenesis, forming a large spot at the lacO array. Worms have red muscle (from L1 stage) and green intestine (from late L4 stage). Reference: Towbin BD, et al. Cell. 2012 Aug 31;150(5):934-47. PMID: 22939621

gwIs39 [baf-1::gfp-lacI::let-858 3'UTR + vit-5::GFP] III. gwIs58 [hsp-16.2p::mCherry::256xLacO::4xLexA + unc-119(+)]. Small transgene/large array. Slow growing and dumpy. Expresses GFP-LacI from early embryogenesis and throughout development, which forms a small spot at the lacO array. Worms have green intestine (from late L4 stage). Might still carry unc-119(ed3) in background. Reference: Rohner S, et al. J Cell Biol. 2013 Mar 4;200(5):589-604. doi: 10.1083/jcb.201207024. PMID: 23460676

gwIs4 [myo-3p::RFP + baf-1::GFP-lacI:::let-858 3'UTR] X. Worms are slow growing, with reduced brood size and become sterile at elevated temperatures. met-2 and set-25 mutants co-segregate with ~ 20cM distance. Expresses GFP-LacI from early embryogenesis and throughout development, which forms a small spot at the lacO array. RFP expression in muscles. Reference: Towbin BD, et al. Cell. 2012 Aug 31;150(5):934-47. PMID: 22939621

gwIs4 [myo-3p::RFP + baf-1::GFP-lacI:::let-858 3'UTR] X. [NOTE: transgene seems prone to silencing. Pick RFP+ to maintain.] Superficially wild-type. Expresses GFP-LacI from early embryogenesis and throughout development, which forms a small spot at the lacO array. RFP expression in muscles. Reference: Meister P, et al. Genes Dev. 2010 Apr 15;24(8):766-82. PMID: 20395364

gwIs39 [baf-1::gfp-lacI::let-858 3'UTR + vit-5::GFP] III. gwIs4 [baf-1p::GFP-lacI::let-858 3’UTR + myo-3p::RFP] X. Superficially wild-type. Expresses GFP-LacI throughout development from early embryogenesis, forming a large spot at the lacO array. Worms have red muscle (from L1 stage) and green intestine (from late L4 stage). Reference: Gonzalez-Sandoval A, et al. Cell. 2015 Dec 3;163(6):1333-47. PMID: 26607792

gwIs4 [myo-3p::RFP + baf-1::GFP-lacI:::let-858 3'UTR] X. Superficially wild-type. Expresses GFP-LacI from early embryogenesis and throughout development, which forms a small spot at the lacO array. Worms have red muscle (from L1 stage). Reference: Gonzalez-Sandoval A, et al. Cell. 2015 Dec 3;163(6):1333-47. doi: 10.1016/j.cell.2015.10.066. PMID: 26607792.

gwSi17 [cec‐4p::cec‐4::WmCherry::cec‐4 3'UTR] II. gwIs4 [baf-1p::GFP-lacI::let-858 3’UTR + myo-3p::RFP] X. Worms are slow growing with reduced brood size and become sterile at elevated temperatures. Expresses GFP-LacI throughout development from early embryogenesis, forming a large spot at the lacO array. Worms have red muscle (from L1 stage). CEC-4::WmCherry is visible at the nuclear periphery in embryos and L1 stage animals. Reference: Cabianca DS, et al. Nature 2019 May;569(7758):734-739. PMID: 31118512

nuIs175 [myo-2p::RFP + unc-129p::RFP::snb-1] X. smn-1 heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP rt248 homozygotes (larval arrest). Homozygous hT2 [bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. NOTE: myo-2p::RFP is not visible in this strain. rt248 is a 8 bp deletion in smn-1. [rt248: TTTTGATTAGC--------ATCCCAAAC] [wild-type: TTTTGATTAGCTCCGTATCATCCCAAAC] Reference: Dimitriadi M, et al. Proc Natl Acad Sci U S A. 2016 Jul 26;113(30):E4377-86. O'Hern PJ, et al. Elife. 2017 May 2;6. pii: e20752.

rtSi10 [smn-1p::smn-1 + Cbr-unc-119(+)] IV. nuIs175 [myo-2p::RFP + unc-129p::RFP::snb-1] X. rtSi10 transgene partially rescues smn-1(ok355): smn-1 homozygotes normally arrest as larvae, but somatic defects, including late larval lethality, are ameliorated by rtSi10. Sterility in smn-1(ok355) homozygotes is not rescued by rtSi10. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok355 homozygotes (sterile due to partial rescue by rtSi10). Homozygous hT2[bli-4 let-? qIs48] inviable. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype. Pick WT GFP and check for correct segregation of progeny to maintain. Reference: O'Hern PJ, et al. eLife 2017;6:e20752 doi: 10.7554/eLife.20752

goeIs288 [flp-11p::mKate2::unc-54 3'UTR + unc-119(+)]. Low copy number insertion. Integration site unknown, but likely not in LG II. Reference: Turek et al. eLife 2016;5:e12499.

Superficially wild-type except for a slightly shorter body length in adults. Crispr/Cas9 was used to create a 13 bp deletion in exon7 of ccar-1a; breakpoints: CTGATTCGGGAG/sda11/ATCGGAAGTTTC. sda11 is an isoform-specific deletion allele. It only affects the function of CCAR-1A and CCAR-1D, but not CCAR-1B and C. In addition, because CCAR-1D is not expressed in embryos,this allele can be used to specifically inactivate CCAR-1A (the full-length isoform that is the most similar to human CCAR1) during embryogenesis. Reference: Fu R, et al. J Cell Sci. 2018 May 10.

sbEx136 [(pAW33.1) let-502p::GFP + rol-6(su1006)]. pAW33.1 is about 6.6 kb BamH1 fragment from K06G1 and includes the first 12 amino acids of LET-502 clones into pPD95.67/BamH1. Should be nuclear localized, but is not nuclear localized. Maintain by picking Rollers.

Dominant temperature sensitive maternal effect lethal. Will segregate some Vab. Maintain at 15C: about 30% of homozygotes hatch at 15C. Will not grow at 20C or 25C. Unc.

Egg-laying (Egl) defects and subsequent internal hatching of progeny (Bagging) in > 95% of animals. xe11 is a C-to-U point mutation in each of the endogenous let-7 complementary sites, LCS1 and LCS2 [I:C9,335,211T & I:C9,335,260T]. xe11 is a weak gain-of-function allele: mutation of two functionally relevant let-7 binding sites impairs repression by let-7 causing over-expression of LIN-41 in L4 stage animals. Reference: Ecsedi M, et al. Dev Cell. 2015 Feb 9;32(3):335-44. Do not distribute this strain; other labs should request it directly from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

Low penetrance Pvl (i.e., tagged protein appears not fully functional). CRISPR/Cas9-engineered allele adds GFP and 3xflag tag to LIN-29. Do not distribute this strain; other labs should request it directly from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. Reference: Aeschimann F, et al., Mol Cell. 2017 Feb 2;65(3):476-489.

Superficially wild-type. CRISPR/Cas9-engineered allele adds GFP and 3xflag tag to the N-terminus of LIN-29A. Do not distribute this strain; other labs should request it directly from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. Reference: Aeschimann F, et al., (2019). A single let-7 target to coordinate transition to adulthood. Life Science Alliance 2, e201900335. http://dx.doi.org/10.26508/lsa.201900335 )

Partially penetrant Pvl and Egl. xe40 specifically disrupts the LIN-29A isoform. The GFP tag was inserted at the shared C-terminus of LIN-29A/B in the xe40 background, so only the labeled B isoform is expressed. Do not distribute this strain; other labs should request it directly from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. Reference: Pereira et al., (2019) Timing mechanism of sexually dimorphic nervous system differentiation. eLIFE 8: e42078. https://doi.org/10.7554/eLife.42078

Pick GFP+ Egl to maintain. Segregates GFP- lin-41(xe8) homozygotes (die by vulval bursting as young adults), lin-41(xe8)/lin-41(bch28[eft-3p::gfp::h2b::tbb-2 3'UTR] xe70) heterozygotes (GFP+ Egl), and lin-41(bch28[eft-3p::gfp::h2b::tbb-2 3'UTR] xe70) (GFP+ Ste Dpy). lin-41(xe8) is a deletion of let-7 binding sites in the lin-41 3'UTR. The balancer was derived from lin-41(bch28), a lin-41(0) allele in which an expression cassette that drives ubiquitous nuclear GFP from the eft-3 promoter has been inserted into the lin-41 coding sequence (Katic et al., G3 (2015) 5:1649-56). References: Katic et al., G3 (2015) 5:1649-56 for lin-41(bch28) starting allele for balancer generation. Aeschimann F, et al. (2019). A single let-7 target to coordinate transition to adulthood. Life Science Alliance 2, e201900335. for balanced line. Do not distribute this strain; other labs should request it directly from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

quEx162 [sax-3p::GFP + rol-6(su1006)]. Pick GFP to maintain. Very bright GFP in early embryos (after 24 cell stage). Not all GFP+ worms are rolling.

Maintain at 15C. At 25C, nr2013 homozygotes are not viable. At 15C, less than 10% of nr2013 homozygotes develop into adults that are marginally fertile, while the majority of worms arrest at different developmental stages and exhibit dramatic defects in morphogenesis. Reference: Pujol N, et al. Curr Biol. 2001 Jun 5;11(11):809-21.

frSi17 [mtl- 2p::rde-1 3'UTR] II. frIs7 [nlp-29p::GFP + col-12p::DsRed] IV. frSi17 inserted into ttTi5605 site using CRISPR/Cas9 engineering. RDE-1 activity is rescued in the intestine, making animals RNAi-deficient except for intestinal tissues. The frSi17 insertion can be detected using a primer within the mtl-2 promoter (jep1061: aacaaacgtgggatgtaacc) in combination with downstream primer in rde-1 (jep2817 tcatactcgtagtattcccg), producing a 786 bp product if insertion is present. rde-1(ne300) can be genotyped by sequencing the PCR product from jep2299: gaacaacgacaatcgagcacca and jep3108: ATcttgtgaccgaactgtcc. (jep3108 is not present in the frSi17 transgene) Reference: Watts JS, et al. G3 (Bethesda) 2020 Nov 5;10(11):4167-4176. PMID: 32943454