Search Strains

ijmSi3 [mex-5p::cls-2(re-encoded)::GFP::tbb-2 3'UTR + Cbr-unc-119(+)] I. ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. The coding sequence of GFP-tagged cls-2 in the transgene was re-coded using silent mutations to render it insensitive to RNAi-depletion of endogenous cls-2 expression. mCherry expression marks histones. Not known if unc-119(ed3) is still carried in the background of this strain. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.] Reference: Schlientz A and Bowerman B. PLoS Genet. 2020 Oct 7;16(10):e1008751. doi: 10.1371/journal.pgen.1008751.

ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. ruIs57 [pie-1p::GFP::tubulin + unc-119(+)]. tmC18 balancer marked with myo-2p::mCherry and Dpy. Heterozygotes are wild-type with pharyngeal mCherry, and segregate mCherry+ heterozygotes, tmC18 homozygotes (mCherry+ Dpy) and non-mCherry klp-15/16 homozygotes. Homozygous double deletion mutants are fertile but produced reduced brood sizes with highly penetrant embryonic lethality; will also segregate some males. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.] Reference: Chuang CH, et al., Biology Open 2020 9: bio052308 doi: 10.1242/bio.052308 Published 25 June 2020

ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. GFP tag inserted into endogenous tac-1 locus. Might still contain unc-119(ed3) in the background. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.] Reference: Chuang CH, et al., Biology Open 2020 9: bio052308 doi: 10.1242/bio.052308 Published 25 June 2020

ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. GFP tag inserted into endogenous zyg-9 locus. Might still contain unc-119(ed3) in the background. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.] Reference: Chuang CH, et al., Biology Open 2020 9: bio052308 doi: 10.1242/bio.052308 Published 25 June 2020

ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. ruIs57 [pie-1p::GFP::tubulin + unc-119(+)]. GFP tag inserted into endogenous aspm-1 locus. tmC18 balancer marked with myo-2p::mCherry and Dpy. Heterozygotes are wild-type with pharyngeal mCherry, and segregate mCherry+ heterozygotes, tmC18 homozygotes (mCherry+ Dpy) and non-mCherry triple mutant homozygotes. Homozygous triple mutants are fertile but produced reduced brood sizes with highly penetrant embryonic lethality; will also segregate some males. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.] Reference: Chuang CH, et al., Biology Open 2020 9: bio052308 doi: 10.1242/bio.052308 Published 25 June 2020

Temperature-sensitive, embryonic-lethal mutant that lacks a central spindle during early embryonic mitosis and exhibits a late cytokinesis defect (cleavage furrows regress after ingressing in nearly to the center of dividing embryonic cells). About 100% of embryos produced by homozygous mothers hatch at 15C; 0% hatch at 26C. ZEN-4 = vertebrate MKLP1 kinesin. There are two mis-sense mutations present in zen-4(or153). One is a D520N (GAC to AAC) and the other is D735N (GAT to AAT). Whether one or both is responsible for the phenotype is not know. Maintain at 15C. Shift L4s to 26 overnight to observe mutant phenotype on embyros produced by adults.

Homozygous or195 hermaphrodites make 100% dead embryos at 26C. One-cell embryo has a very small but bipolar spindle, severe chromosome segregation defect. Maintain at 15C. Previously called spd-4. 2/06: From Bruce Bowerman: The or195 mutation changes base 10,679 of the cosmid clone T21E12 from a C to a T. This corresponds to dhc-1 cDNA nucleotide 9599 (WS153) , which is the center nucleotide of codon 3200. This codon changes from Serine in N2 to Leucine in or195 (S3200L). Note: this is not the same mutation for or195ts that we reported in Hamill et al, 2002(Dev Cell 3, 673-684). The mutation reported in our paper is not present in this strain. We apologize for the confusion. The pairs dhc-11a,b amplify the mutated fragment in dhc-1(or195). The mutation is near the center of this fragment; a clean (gel purified) DNA prep helps get a good read of it. dhc-11b: 5' aacagacgcacgattgacct 3'. dhc-11a: 5' ctcaaatcaaggaaggagct 3'. PCR conditions: 5 min at 94 degrees C; 30 sec at 94 degrees C; 30 sec at 55 degrees C; 1 min at 72 degrees C. 35 Cycles using Taq polymerase.

zzIs16 [(pJE3) eff-1p::GFP + rol-6(su1006)]. GFP+ Rollers. Chromosomal insertion of zzEx10. Integration site of zzIs16 not yet mapped, but it is not tightly linked to eff-1 II, unc-119 III, or jcIs1 IV. pJE3 has 7.5 kb of eff-1 upstream sequence inserted into pPD95.75, driving cytoplasmic GFP expression.

gei-17(fgp1[GFP::FLAG::degron::loxP::gei-17]) I. ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.] Reference: Pelisch et al. Mol Cell. 2017 Jan 5;65(1):66-77.

cdk-5(gm336) mutants exhibit defects in polarized trafficking of dense-core vesicles in motor neurons, and decreased localization of GLR-1::GFP to puncta in ventral nerve cord interneurons. Note that this strain does not contain GLR-1::GFP. References: Juo P, et al. Mol Biol Cell. 2007 Oct;18(10):3883-93. Goodwin PR, et al. J Neurosci. 2012 Jun 13;32(24):8158-72.

Made by crossing MT3353 egl-15(n484) sma-5(n678) with N2 males and selecting animals that grew much better. FK312 probably only carries the sma-5(n678) mutation but that has not been confirmed by sequencing. Small body size, slow growth, abnormal intestinal granules, shorter lifespan than WT.

xnIs449 [lin-26::lifeAct::GFP + unc-119(+)]. LifeAct-GFP expressed in epidermal cells of embryos. In adults, expression is also observed in pharynx and some cells in the tail. Reference: Zilberman, Y., J. Abrams, D.C. Anderson, and J. Nance. 2017. Cdc42 regulates junctional actin but not cell polarization in the Caenorhabditis elegans epidermis. J Cell Biol 216: 3729-3744.

xnIs506 [cdc42p::GST::GFP::wsp-1(GBD) + unc-119(+)]. Biosensor for active CDC-42. In epithelia, GFP is enriched at junctions between epithelial cells. Some signal is in the nucleus (this signal is reduced by addition of GST, which makes the transgenic protein larger). Reference: Zilberman, Y., J. Abrams, D.C. Anderson, and J. Nance. 2017. Cdc42 regulates junctional actin but not cell polarization in the Caenorhabditis elegans epidermis. J Cell Biol 216: 3729-3744.

xnIs243 [picc-1p::picc-1::GFP + unc-119(+)]. Weak maternal expression visible at early embryo cell contacts. Stronger zygotic expression visible at junctions of epithelial cells. Transgene generated from a recombineered genomic fosmid clone. Reference: Zilberman, Y., J. Abrams, D.C. Anderson, and J. Nance. 2017. Cdc42 regulates junctional actin but not cell polarization in the Caenorhabditis elegans epidermis. J Cell Biol 216: 3729-3744.

Homozygous viable. 775 bp deletion. 24926/24927 - 25701/25702. Primer 1: att gcc aat gcc gtt ctt cc (forward primer to the left of deletion). Primer 2: tat tat ttc gcg tcg gag cg (forward primer lies in the deletion). Primer 3: att tat gca gga gcg gca ag (reverse primer to the right of deletion). In sod-5(+) you see 720 bp product with primer 2 and 3. reliable PCR. in sod-5(+) expected product size is 1315 bp with primer 1 and 3. not always reliable. In sod-5 (tm1146) you see 540 bp product with primer 1 and 3. reliable PCR. In sod-5(tm1146), you see no product with primer 2 and 3. Attribution: This strain was generated by the National Bioresource Project at the Tokyo Women's Medical University School of Medicine, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Break points: In(F53G12.8 T02E1.7 In(gsp-3 sre-23)) I. Covered region (Mb) 8.1 (0.1..8.3) Balancer marked with myo-2p::Venus. tmIs1219 is inserted in unc-14, but Unc phenotype is not detectable. Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.

Break points: In(mak-2 unc-8 In(kvs-5 dmd-9)) IV. Covered region (Mb) 6.5 (0.7..7.2) One breakpoint is in unc-8, but Unc phenotype is not detectable. Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.

Break points: lin-42 II. Covered region (Mb) (1.2) Balancer marked with myo-2p::mCherry. tmIs1226 is integrated in the same site as tmIs1246, but Egl phenotype is not detectable. [NOTE: the genotype originally listed for this strain in Table 2 of Dejima, et al. was incorrect.] Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.

Heterozygotes segregate wild-type heterozygotes, Dpy, and sec-5 homozygotes (scrawny, small broods, abnormal gut appearance) sec-5 is homozygous maternal-effect lethal; M+Z- animals produce a few dead L1-L2 stage larvae with Vab defects. Based upon phenotype, pk2357 is a strong loss-of-function, but likely not a null allele; molecular lesion produces a premature stop at position 389. Reference: Frische EW, et al. EMBO J. 2007 Dec 12;26(24):5083-92. [NOTE: This strain was previously described as carrying pk2358, but pk2357 is the correct allele. Both pk2357 and pk2358 cause the same nonsense (amber) change.]

Bacteria. E. coli HT115(DE3) bacterial strain carrying pGC8. pGC8 is a partial cDNA of him-14 (ZK1127.11) cloned into the Timmons and Fire "double T-7 vector" L4440. The source of the cDNA is Yuji Kohara's clone yk240h12. pGC8 was constructed by inserting the 1.65kb KpnI/SacI fragment of the him-14 cDNA (from base pair 1071 to 192 base pairs beyond the stop codon) into the same sites in L4440. HT115(DE3) carrying pGC8 should be selected in the presence of 50 um/ml tetracyline and 100 um/ml ampicillin. Prior to an actual feeding experiment, it can be grown in liquid in the presence of amp alone (no tet) and then seeded onto NGM plates containing amp and 1 mM IPTG. This technique does not work well if the cells are old; therefore, the strain should be seeded onto IPTG-containing plates from a fresh overnight that was grown from a colony on an amp/tet plate. Biosafety Level: BSL-1. For more info see http://www.wormbook.org/wli/wbg17.1p32/

naEx75 [(pGC146) hsp-16.2p::FLP::let-858 3'UTR) + Cbr-unc-119(+) + (pCW2.1) ceh-22p::GFP)]. Array was bombarded but did not integrate.

naIs7 [hsp-16.2p::FLP::let-858 3'UTR + Cbr-unc-119(+)]. Does not express ceh-22p::GFP, but unc-119 is rescued.

Maternal effect lethal mutation linked to unc-24(e138) and pseudolinked to dpy-11(e224), and balanced by recessive lethal translocation. Heterozygotes are WT and segregate WT, arrested nT1 aneuploids, arrested nT1 homozygotes, and viable DpyUnc t1773 homozygotes that do not produce viable progeny. GE2153 is also homozygous for xpf-1(e1487) so that male progeny are segregated. Pick WT and check for correct segregation of progeny to maintain. Please reference Li-Leger et al., G3 11(12) 2021 in any work resulting from use of this mutation. xpf-1 previously known as him-9.

Maternal-effect lethal mutation linked to unc-32(e189) and balanced by glp-1- and dpy-19-marked recombination suppressor. Heterozygotes are WT, and segregate WT, sterile ts-Dpy qC1 homozygotes, and viable Unc t1614 homozygotes that do not produce viable progeny. GE2237 is also homozygous for him-3(e1147) so that male progeny are segregated. Pick WT and check for correct segregation of progeny to maintain. Please reference Li-Leger et al., G3 11(12) 2021 in any work resulting from use of this mutation.

Maternal-effect lethal mutation linked to unc-32(e189) and balanced by glp-1- and dpy-19-marked recombination suppressor. Heterozygotes are WT, and segregate WT, sterile ts-Dpy qC1 homozygotes, and viable Unc t1496 homozygotes that do not produce viable progeny. GE2277 is also homozygous for him-3(e1147) so that male progeny are segregated. Pick WT and check for correct segregation of progeny to maintain. Please reference Li-Leger et al., G3 11(12) 2021 in any work resulting from use of this mutation.

Maternal effect lethal mutation linked to unc-24(e138) and pseudolinked to dpy-11(e224), and balanced by recessive lethal translocation. Heterozygotes are WT and segregate WT, arrested nT1 aneuploids, arrested nT1 homozygotes, and viable DpyUnc t1867 homozygotes that do not produce viable progeny. GE2305 is also homozygous for xpf-1(e1487) so that male progeny are segregated. Pick WT and check for correct segregation of progeny to maintain. Please reference Li-Leger et al., G3 11(12) 2021 in any work resulting from use of this mutation. xpf-1 previously known as him-9.

Maternal-effect lethal mutation linked to unc-32(e189) and balanced by glp-1- and dpy-19-marked recombination suppressor. Heterozygotes are WT, and segregate WT, sterile ts-Dpy qC1 homozygotes, and viable Unc t1674 homozygotes that do not produce viable progeny. GE2605 is also homozygous for him-3(e1147) so that male progeny are segregated. Pick WT and check for correct segregation of progeny to maintain. Please reference Li-Leger et al., G3 11(12) 2021 in any work resulting from use of this mutation.

Heterozygotes are WT and segregate WT, DpySteriles, and Uncs which give only dead eggs.

Heterozygotes are WT and segregate WT, DpySteriles, and Uncs which give only dead eggs.

Maternal-effect lethal mutation linked to unc-32(e189) and balanced by glp-1- and dpy-19-marked recombination suppressor. Heterozygotes are WT, and segregate WT, sterile ts-Dpy qC1 homozygotes, and viable Unc t1693 homozygotes that do not produce viable progeny. GE2666 is also homozygous for him-3(e1147) so that male progeny are segregated. Pick WT and check for correct segregation of progeny to maintain. Please reference Li-Leger et al., G3 11(12) 2021 in any work resulting from use of this mutation.

Heterozygotes are WT and segregate WT, DpySteriles and Uncs which give only dead eggs. This strain was mistakenly called emb-30 in the paper; it is not an emb-30 allele.

Sterile at 25C, maintain at 15C. NOTE (11/16/10 - J. Hubbard): This strain is NOT synonymous with glp-1(e2141) as previously reported in Kodoyianni V, Maine EM, Kimble J. (1992) [Molecular basis of loss-of-function mutations in the glp-1 gene of Caenorhabditis elegans. Mol Biol Cell. 3,1199-213. PMID: 1457827]. As reported in WBG article by Dalfó D, Priess J, Schnabel R and Hubbard J. (2010) [glp-1(e2141) sequence correction. The Worm Breeders Gazette. 18-3.], e2144 carries the mutation c2785t in exon 8, leading to the amino acid change L929F, whereas e2141 carries the mutations c2920t and a3610g in exon 8, leading to the amino acid changes R974C and T1204A.

Temperature sensitive. Maintain at 15C. Will also grow at 20C, but not 25C.

Slow moving Unc. Cannot back. Hypercontracts when you tap nose.

Temperature sensitive. Maintain at 15C, will not grow at 25C.

Temperature sensitive. Maintain at 15C. Will grow at 20C, but not at 25C. [11/93: Not behaving as described. Very sick at 25C, but giving some live offspring which in turn give a few more live offspring.]

Temperature sensitive. Maintain at 15C. Will grow at 20C, but not 25C.

Temperature sensitive. Maintain at 15C. Embryonic lethal.(Some growth at 20C.) [11/93: Not behaving as described. Very sick at 25C, but giving some live offspring which in turn give a few more live offspring.]

Temperature sensitive. Accumulates dead eggs at permissive temperature (15C). Will grow at 20C, but not 25C. [5/95: Not tight at 25C - a few embryos are surviving and reproducing.]

Temperature sensitive. Maintain at 15C. Will grow at 20C, but not at 25C.

Temperature sensitive. Maintain at 15C. Will also grow at 20C, but not 25C.

Temperature sensitive. Maintain at 15C. Will grow at 20C, but not 25C.

Temperature sensitive. Grow at 15C. Some growth at 20C. Does not grow at 25C.

Accumulates dead eggs at permissive temperature (15C). Will grow at 20C, but not at 25C. g60 pka emb-33.

Temperature sensitive-maintain at 15C. Some growth at 20C. Does not grow at 25C.

Temperature sensitive. Maintain at 15C. Will grow at 20C, but not at 25C.

pgIs22 [unc-70::N-TSmod]. oxIs95 [pdi-2p::unc-70 + myo-2p::GFP]. The tension sensor module control (N-TSMod) was inserted at the N-terminus of unc-70. N-TSmod consists of a donor (mTFP) and acceptor (Venus) fluorophore separated by a flexible linker made of 40 residues from the spider-silk flagelliform, but is placed at the N-terminus of UNC-70 where it is not sensitive to force. pgIs22 was a spontaneous insertion of pgEx157. Reference: Kelley M, et al. Elife. 2015 Mar 23;4.

Constructed by crossing individual fluorescence knock-in worms. GFP inserted into the endogenous che-3 locus at the N-terminus and tagRFP::3xFlag inserted into the endogenous xbx-1 locus at the C-terminus by Cas9-triggered homologous recombination. Fluorescence enriched in most if not all sensory cilia. Very weak fluorescence in the cell bodies of ciliated neurons.

GFP inserted into the endogenous ift-74 locus at the C-terminus by Cas9-triggered homologous recombination. Green fluorescence enriched in most, if not, all sensory cilia. Very weak fluorescence in the cell bodies of ciliated neurons.

DpyUnc. At 25C ar22 recessively suppresses the Egl defect of n676n930. At 15C ar22 dominantly suppresses the 2 AC-Egl phenotype of n676n930. Suppresses the vulval lineage defects and proximal mitosis defects of lin-12. Do not distribute this strain; other labs should request it from the CGC.